Supplemental_Tables.xlsx - Genes & Development
A00068, A01:391691-394204, AT4G39660, AGT2. 14, Brara.A00072, A01:413104- ... 5544, Brara.J01925, A10:15369624-15372749, AT5G15870. 5545, Brara.
Supplemental_Tables.xlsx - Genes & Development - Related Phones
A00068, A01:391691-394204, AT4G39660, AGT2. 14, Brara.A00072, A01:413104- ... 5544, Brara.J01925, A10:15369624-15372749, AT5G15870. 5545, Brara.
6 days ago ... Reference: 20/01443/FUL. Community Cnl: Dundasvale (Inactive) ... Cons Area: Glasgow West. Map Reference: (E) 256133 (N) 667600 ...
... LINC01208 · LINC01209 · LINC01210 · LINC01213 · LINC01214 · LINC01215 · LINC01216 · LINC01217 · LINC01218 · LINC01219 · LINC01220 · LINC01221 ...
G6PC2_rs560887. 3,50E-07 ... G6PC2_rs560887. 1,11E-06 ... 1,942. 0,000001. SERPINF1 serpin peptidase inhibitor, clade F (alpha-2 antiplasmin). 7968199 ...
858, PA0844, 919258, 921450, -, hemolytic phospholipase C, NA, NA, NA, 1 ... 2286, PA2253, 2480844, 2481830, , L-asparaginase I, NA, NA, NA, 1, 1550.
620, pgap, AYM39_02980, 653059, 653733, -, 4, girp, 675, 0, 653059, hypothetical ... protein|][proka|PROKKA_01636||Phage Tail Collar Domain protein|].
295, YALI0A06237r, YALI1_A06020r, tRNA, YALI1A, 601943, 602013, -, codon ... 5273, YALI0E01298g, YALI1_E01865g, mRNA, YALI1E, 186136, 186525, ...
... HQ292138 HQ292139 HQ292140 HQ292141 HQ292142 HQ292143 HQ292144 ... LINC01680 LINC01681 LINC01682 LINC01683 LINC01684 LINC01685 ...
Development 2005 132: 4911-4925; doi: 10.1242/dev.02077 ... The Dorsocross genes are induced within the segmental areas of the dorsal mesoderm ... of stage 14 embryos fluorescently labeled for markers, as indicated by the color code.
11, Muc4, ENSMUSG00000079620.13, 1154.80790, 8.35357, 0.86915, 9.61118, 7.17E-22, 6.13E- ... 12.59838, 7.16797, 1.26374, 5.67201, 1.41E-08, 2.11E-07.
12q24, 12p13, Cosmic_SV, u(12)(q24;p13), Cosmic_SV [COST744194] ... chr12:110936602-110937446 , 12q24, Gene [G], LINC01405 · [Omim] · [Entrez].
1389, ZtritIPO323_04t01639, 1:4250848-4251874, 7.28921, 5.52153, 34.7204 ... 2581, ZtritIPO323_04t09640, 5:617324-618971, 180.981, 38.5618, 47.3829 ...
Ciunshiu_m01256, scaffold00113, 500216, 502947, -. Ciunshiu_m01257 ... Ciunshiu_m16140, scaffold00180, 305601, 306797, -. Ciunshiu_m16141 ...
25 Apr 2013 ... ... 2.011458763 down 0.000629733 0.007784017 BF424030 439 48 144 ... CAGAGACGAACCTTGAGGAGA 1 1 control (188) (189) 64 J01298 ...
23301 26212 30851 37220 4467S (.471(,0 01446 10004 i 397 1-4 0 Rl- 4 4 Rl ... 16031 386010 38692 35176 59767 11231:02530 7330 29040 40492 59739 ...
18 Jun 2020 ... Virology Journal volume 17, Article number: 79 (2020) Cite this article ... Virol J 17, 79 (2020). https://doi.org/10.1186/s12985-020-01345-7.
DOI: 10.1128/AEM.01254-08. Article · Figures & Data · Info & Metrics · PDF. Loading ... Immun.12:404-410. OpenUrlAbstract/FREE Full TextGoogle Scholar. 22.↵.
5045, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA ... 5458, RN7SKP244, RN7SK Pseudogene 244, Pseudogene, 8, GC04M088584, 0.29.
... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 1.03 ... 6330, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA ...
348, LINC01224, Long Intergenic Non-Protein Coding RNA 1224, RNA Gene, 10, GC19M024473, 0.03 ... 7396, lnc-RIT2-1, RNA Gene, 4, GC18M042186, 0.33.
11 Jun 2019 ... MMP12 induces the aggregation of various inflammatory cells into ... SERPINB4, Up-regulated, 2.806586, 6.991864, 4.92E-18, 5.32E-15.
gene ESTs_{Incyte_PD:9669481 966948. Figure US20040241653A1-20041202-C00025. gene ESTs ... Figure US20040241653A1-20041202-C01792. 1.4.
3568, RF00017-4906, RNA Gene, 5, GC05P135472, 0.25 ... 5338, LINC01582, Long Intergenic Non-Protein Coding RNA 1582, RNA Gene, 11, GC15M102793 ...
... Dept of Medicine, John Radcliffe Hospital, Headington, Oxford, UK OX3 9DU. Search for articles by this author. DOI:https://doi.org/10.1016/S1471-4922(01)02079-7 ... 1 codes for the variable extracellular domain and transmembrane region, and ... two domains figured prominently in the PfEMP1 extracellular region: the ...
347 348 RXA00041 GR00007 1246 5 SUCROSE-6-PHOSPHATE ... 24 Homo sapiens 39,618 2-NOV-99 unordered pieces rxa01332 576 GB HTG6 AC007186 ...
Cre16.g651550, Mitochondrial transcription termination factor family protein, AT1G74120 · g16741, calmodulin 6, ACAM-6 CAM6, AT5G21274 · PTHR23050 ...
4 May 2020 ... ... 20,000, even though the entire genome is predicted to code over 200,000 transcripts. ... A second area of application is the nature of the profound differences ... Med. 5, 21 (2020). https://doi.org/10.1038/s41525-020-0128-1.
2302, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA ... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 1.29.
12q24, 12p13, Cosmic_SV, u(12)(q24;p13), Cosmic_SV [COST744194] ... chr12:110936602-110937446 , 12q24, Gene [G], LINC01405 · [Omim] · [Entrez].
HPIV1/WI/629-D01202/2009 (JQ901992). HPIV1/WI/629-D01790/2009 ... HPIV1/WI/629-006/1997 (JQ901977). HPIV1/WI/629-004/1997 (JQ901973).
3920, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA ... 4307, RN7SKP244, RN7SK Pseudogene 244, Pseudogene, 8, GC04M088584, 0.28.
... HL005PA2] hypothetical protein HMPREF9569_01292 [Propionibacterium ... 304 ## COG2964 Uncharacterized protein conserved in bacteria 256 138 Op 1 .
20, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA Gene ... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 0.91.
... 2599812, , hypothetical protein (NCBI ptt file), False. BC2634, BC2634, CDS, -, chromosome, 2600542, 2601207, , Cytochrome P450 (NCBI ptt file), False.
1430, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA ... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 0.43.
... AF244686 AAG34798.1 AF243363 AAG34837.1 AF244694 AAG34849.1 ... L3 6456 L36823 AF14 6691 Z37 991 AJ001926 AJO 01925 AJO 01924 X72 675 ...
19 Mar 2019 ... 2003;31:1805–1812. doi: 10.1093/nar/gkg274. [PMC free article] [PubMed] [CrossRef] [Google Scholar]. 20. Loenen W.A.M., Dryden D.T.F., ...
Keywords: Coronavirus, Severe acute respiratory syndrome, SARS-CoV, ... To compare the gene-finding result of the system ZCURVE_CoV 1.0 with that of ...
16 Aug 2013 ... ... Abelson-related gene) 2292936;2293000 PRSTS117_H;PRSTS118_H APPROVED protein-coding ENSG00000143322 77 01259 164690 ...
4044, LINC01977, Long Intergenic Non-Protein Coding RNA 1977, RNA Gene, 8, GC17P079826 ... 6526, lnc-DIRC3-6, RNA Gene, 4, GC02M216992, 0.47.
Synpcc7942_0844, CDS, 3774021, chromosome, 839099, 839809 ... Synpcc7942_2383, CDS, 3774667, chromosome, 2450109, 2451260, , "Nucleotide ...
2627, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA Gene, 9 ... Uncharacterized LOC101927858, RNA Gene, 5, GC07M156654, 0.11.
199, FECH, Ferrochelatase, Protein Coding, 47, GC18M057544, 0.29 ... 4893, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA Gene, 9 ...
... ;AMYH02031662;AV648626;AV653851;AV696798;BC013753;BC016703 ... EAX01923;EAX01924;EAX01925;EAX01926;EAX01927;EAX01928;NP_005726 ...
... NV15177-PA AGAP004066-PA Msex2.01246-RA FBpp0083649 14 14 0.427 ... EHJ73422 DPOGS211038-PA GB51727-PA TC004918-PA CCG013314.1 ...
TELEPHONE NUMBER (COUNTRY CODE AREA CODE TEL. NO.) FATHER ... COV-01214 (09-2015). SS NUMBER. E-1. 3. ... BUSINESS CODE. (FOR SE).
... House, Walderslade Centre, Chatham, Kent, ME5 9UD, 01634 673800, 05/02/2014 ... Blackbrook House, Dorking, RH4 1HJ, 01306 888000, 06/17/2015.
mosomal somatic cell hybrid panel (Bios Laboratories; code #SCB- ... amygdaloid nucleus; LM = lateral mammillary nucleus; AHi = amygdalohippocampal area; ...
... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 0.07 ... 3004, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA ...
... panelSherry L.WinterLucineBosnoyan-CollinsDushanthiPinnaduwageIrene L.Andrulis. Show more. https://doi.org/10.1593/neo.07595Get rights and content.
10 Jun 2020 ... ... (3) Genes that code for checkpoint control proteins trigger cell cycle stagnation ... in the transcriptional activation area of the N-terminal domain and the ... Target Ther 5, 90 (2020). https://doi.org/10.1038/s41392-020-0196-9.
... REVIEWED AB505429;AB505430;AC091842;AF062649;AF075242;AF095287 ... AAB82299;AAC39534;AAG17208;AAG17215;AAH08280;ABQ01233 ...
4-14-00-01273 (Beilstein Handbook Reference). 4-amino-2-Chlorobenzoate ... NCI60_030812. neo Artrol. NINDS_000804. novo Flurprofen. novo-Flurprofen.
14 Jul 2020 ... The UK Biobank (UKBB) is a flagship project of these efforts, having recruited ... mean (solid line) and standard deviation (shaded area) of the effect scores of ... When testing phenotypes defined by ICD-10 codes, we filtered out all ... Genome Biol 21, 173 (2020). https://doi.org/10.1186/s13059-020-02089-x.
23 Jan 2020 ... Potential ARGs were detected in dust isolate genomes, and we ... of an ARG from the CARD database, in order to avoid false positives.
1763, 1656, 1218149, Замок хомута 9 мм TORK Турция, 16.52. 1764, 1.16. ... 0,800мм*30м, есть, 280.50. 5409, 5130, 9021, Шкурка на тканев.основе ...
SONEGAON PATODA AT&POST-DASKHRD City:BEED. Phone:02442-244694(M) 9421342435 9423400000 ... APW01925. VIVEK VARDHANI COLLEGE OF ...
6,833166 6,8151013 6,255295667 -0,55980567. 4,930899 5 ... 17323081 7,0207596,833166 5,538308. 5,089349 ... 17312223 9,968389 10,55154 10, 01709.
axo03451-f_at. 0.0000419. 1.1013508 myosin binding protein C, slow ... hypothetical protein LOC128876 [Homo sapiens]. FAM83C axo27766-f_at. 0.0004310.
22 Març 2018 ... 3330 145 #145 - Zapdos 3300 112 #112 - Rhydon 3281 130 #130 - Gyarados 3272 146 #146 - Moltres 3219 242 242 - Blissey 3157 134 #134 ...