Genes List as text - GeneCards

Genes List as text - GeneCards - Related Phones

... HQ292138 HQ292139 HQ292140 HQ292141 HQ292142 HQ292143 HQ292144 ... LINC01680 LINC01681 LINC01682 LINC01683 LINC01684 LINC01685 ...

Active

... LINC01208 · LINC01209 · LINC01210 · LINC01213 · LINC01214 · LINC01215 · LINC01216 · LINC01217 · LINC01218 · LINC01219 · LINC01220 · LINC01221 ...

Active

3568, RF00017-4906, RNA Gene, 5, GC05P135472, 0.25 ... 5338, LINC01582, Long Intergenic Non-Protein Coding RNA 1582, RNA Gene, 11, GC15M102793 ...

Active

5045, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA ... 5458, RN7SKP244, RN7SK Pseudogene 244, Pseudogene, 8, GC04M088584, 0.29.

Active

348, LINC01224, Long Intergenic Non-Protein Coding RNA 1224, RNA Gene, 10, GC19M024473, 0.03 ... 7396, lnc-RIT2-1, RNA Gene, 4, GC18M042186, 0.33.

Active

... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 1.03 ... 6330, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA ...

Active

1430, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA ... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 0.43.

Active

20, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA Gene ... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 0.91.

Active

3920, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA ... 4307, RN7SKP244, RN7SK Pseudogene 244, Pseudogene, 8, GC04M088584, 0.28.

Active

2627, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA Gene, 9 ... Uncharacterized LOC101927858, RNA Gene, 5, GC07M156654, 0.11.

Active

199, FECH, Ferrochelatase, Protein Coding, 47, GC18M057544, 0.29 ... 4893, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA Gene, 9 ...

Active

2302, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA ... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 1.29.

Active

4044, LINC01977, Long Intergenic Non-Protein Coding RNA 1977, RNA Gene, 8, GC17P079826 ... 6526, lnc-DIRC3-6, RNA Gene, 4, GC02M216992, 0.47.

Active

... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 0.07 ... 3004, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA ...

Active

Ciunshiu_m01256, scaffold00113, 500216, 502947, -. Ciunshiu_m01257 ... Ciunshiu_m16140, scaffold00180, 305601, 306797, -. Ciunshiu_m16141 ...

Active

... rs199706846 rs142249822 rs148289726 rs143886639 rs151179474 rs199918580 rs145129032 rs760012398 rs199947288 rs201215681 rs202246914 ...

Active

2003, 31, 1805–1812. [Google Scholar] [CrossRef]; Loenen, W.A.M.; Dryden, D.T.F.; Raleigh, E.A.; Wilson, G.G. Type I restriction enzymes and their relatives.

Active

12 Jan 2020 ... How to send text messages from email, via SMS and MMS gateways. ... Virgin Mobile: [email protected] (SMS), [email protected] (MMS) ...

Active

... 680 14,500 14, 500 13, 680 9,700 9,700 9,700 3,750 3,750 3,750 1,085 12, 500 12, 500 1,800 1,800 255 273 170 170 170 Type. lst-class battle ship .do do :.

Active

F P Public Service Electric «, Gas Co of New Jeriey 00/08/13 3pp — 8000190537 LER 80-013/03L-0 on 9007 14. dur i ng routine tour, 21 Si 22CE spray header ...

Active

3332120183. 101060665. Civil. Police. Vert. OBC-M. VISHAL. RATHI. Yes. NO. No. No. Male. 190.5. No. No. No. UP. 2136. 39926. 3292180727. 100788149.

Active

3332120183. 101060665. Civil. Police. Vert. OBC-M. VISHAL. RATHI. Yes. NO. No. No. Male. 190.5. No. No. No. UP. 2136. 39926. 3292180727. 100788149.

Active

858, PA0844, 919258, 921450, -, hemolytic phospholipase C, NA, NA, NA, 1 ... 2286, PA2253, 2480844, 2481830, , L-asparaginase I, NA, NA, NA, 1, 1550.

Active

G6PC2_rs560887. 3,50E-07 ... G6PC2_rs560887. 1,11E-06 ... 1,942. 0,000001. SERPINF1 serpin peptidase inhibitor, clade F (alpha-2 antiplasmin). 7968199 ...

Active

620, pgap, AYM39_02980, 653059, 653733, -, 4, girp, 675, 0, 653059, hypothetical ... protein|][proka|PROKKA_01636||Phage Tail Collar Domain protein|].

Active

295, YALI0A06237r, YALI1_A06020r, tRNA, YALI1A, 601943, 602013, -, codon ... 5273, YALI0E01298g, YALI1_E01865g, mRNA, YALI1E, 186136, 186525,  ...

Active

11, Muc4, ENSMUSG00000079620.13, 1154.80790, 8.35357, 0.86915, 9.61118, 7.17E-22, 6.13E- ... 12.59838, 7.16797, 1.26374, 5.67201, 1.41E-08, 2.11E-07.

Active

1389, ZtritIPO323_04t01639, 1:4250848-4251874, 7.28921, 5.52153, 34.7204 ... 2581, ZtritIPO323_04t09640, 5:617324-618971, 180.981, 38.5618, 47.3829 ...

Active

A00068, A01:391691-394204, AT4G39660, AGT2. 14, Brara.A00072, A01:413104- ... 5544, Brara.J01925, A10:15369624-15372749, AT5G15870. 5545, Brara.

Active

12q24, 12p13, Cosmic_SV, u(12)(q24;p13), Cosmic_SV [COST744194] ... chr12:110936602-110937446 , 12q24, Gene [G], LINC01405 · [Omim] · [Entrez].

Active

Development 2005 132: 4911-4925; doi: 10.1242/dev.02077 ... The Dorsocross genes are induced within the segmental areas of the dorsal mesoderm ... of stage 14 embryos fluorescently labeled for markers, as indicated by the color code.

Active

Cre16.g651550, Mitochondrial transcription termination factor family protein, AT1G74120 · g16741, calmodulin 6, ACAM-6 CAM6, AT5G21274 · PTHR23050 ...

Active

11 Jun 2019 ... MMP12 induces the aggregation of various inflammatory cells into ... SERPINB4, Up-regulated, 2.806586, 6.991864, 4.92E-18, 5.32E-15.

Active

23301 26212 30851 37220 4467S (.471(,0 01446 10004 i 397 1-4 0 Rl- 4 4 Rl ... 16031 386010 38692 35176 59767 11231:02530 7330 29040 40492 59739 ...

Active

... Dept of Medicine, John Radcliffe Hospital, Headington, Oxford, UK OX3 9DU. Search for articles by this author. DOI:https://doi.org/10.1016/S1471-4922(01)02079-7 ... 1 codes for the variable extracellular domain and transmembrane region, and ... two domains figured prominently in the PfEMP1 extracellular region: the ...

Active

4 May 2020 ... ... 20,000, even though the entire genome is predicted to code over 200,000 transcripts. ... A second area of application is the nature of the profound differences ... Med. 5, 21 (2020). https://doi.org/10.1038/s41525-020-0128-1.

Active

25 Apr 2013 ... ... 2.011458763 down 0.000629733 0.007784017 BF424030 439 48 144 ... CAGAGACGAACCTTGAGGAGA 1 1 control (188) (189) 64 J01298 ...

Active

347 348 RXA00041 GR00007 1246 5 SUCROSE-6-PHOSPHATE ... 24 Homo sapiens 39,618 2-NOV-99 unordered pieces rxa01332 576 GB HTG6 AC007186 ...

Active

18 Jun 2020 ... Virology Journal volume 17, Article number: 79 (2020) Cite this article ... Virol J 17, 79 (2020). https://doi.org/10.1186/s12985-020-01345-7.

Active

DOI: 10.1128/AEM.01254-08. Article · Figures & Data · Info & Metrics · PDF. Loading ... Immun.12:404-410. OpenUrlAbstract/FREE Full TextGoogle Scholar. 22.↵.

Active

gene ESTs_{Incyte_PD:9669481 966948. Figure US20040241653A1-20041202-C00025. gene ESTs ... Figure US20040241653A1-20041202-C01792. 1.4.

Active

A01473-1 · M01473 · Search for GRK2 Antibodies ... JH376180.1:102049-107507 · 426000 · NM_001031353.1 · NP_001026524.1. lizard. (Anolis carolinensis).

Active

12q24, 12p13, Cosmic_SV, u(12)(q24;p13), Cosmic_SV [COST744194] ... chr12:110936602-110937446 , 12q24, Gene [G], LINC01405 · [Omim] · [Entrez].

Active

Synpcc7942_0844, CDS, 3774021, chromosome, 839099, 839809 ... Synpcc7942_2383, CDS, 3774667, chromosome, 2450109, 2451260, , "Nucleotide ...

Active

... HL005PA2] hypothetical protein HMPREF9569_01292 [Propionibacterium ... 304 ## COG2964 Uncharacterized protein conserved in bacteria 256 138 Op 1 .

Active

... AF244686 AAG34798.1 AF243363 AAG34837.1 AF244694 AAG34849.1 ... L3 6456 L36823 AF14 6691 Z37 991 AJ001926 AJO 01925 AJO 01924 X72 675 ...

Active

... ;AMYH02031662;AV648626;AV653851;AV696798;BC013753;BC016703 ... EAX01923;EAX01924;EAX01925;EAX01926;EAX01927;EAX01928;NP_005726 ...

Active

HPIV1/WI/629-D01202/2009 (JQ901992). HPIV1/WI/629-D01790/2009 ... HPIV1/WI/629-006/1997 (JQ901977). HPIV1/WI/629-004/1997 (JQ901973).

Active

16 Aug 2013 ... ... Abelson-related gene) 2292936;2293000 PRSTS117_H;PRSTS118_H APPROVED protein-coding ENSG00000143322 77 01259 164690 ...

Active

... NV15177-PA AGAP004066-PA Msex2.01246-RA FBpp0083649 14 14 0.427 ... EHJ73422 DPOGS211038-PA GB51727-PA TC004918-PA CCG013314.1 ...

Active

... 2599812, , hypothetical protein (NCBI ptt file), False. BC2634, BC2634, CDS, -, chromosome, 2600542, 2601207, , Cytochrome P450 (NCBI ptt file), False.

Active

19 Mar 2019 ... 2003;31:1805–1812. doi: 10.1093/nar/gkg274. [PMC free article] [PubMed] [CrossRef] [Google Scholar]. 20. Loenen W.A.M., Dryden D.T.F., ...

Active

Keywords: Coronavirus, Severe acute respiratory syndrome, SARS-CoV, ... To compare the gene-finding result of the system ZCURVE_CoV 1.0 with that of ...

Active

... panelSherry L.WinterLucineBosnoyan-CollinsDushanthiPinnaduwageIrene L.Andrulis. Show more. https://doi.org/10.1593/neo.07595Get rights and content.

Active

23 Jan 2020 ... Potential ARGs were detected in dust isolate genomes, and we ... of an ARG from the CARD database, in order to avoid false positives.

Active

14 Jul 2020 ... The UK Biobank (UKBB) is a flagship project of these efforts, having recruited ... mean (solid line) and standard deviation (shaded area) of the effect scores of ... When testing phenotypes defined by ICD-10 codes, we filtered out all ... Genome Biol 21, 173 (2020). https://doi.org/10.1186/s13059-020-02089-x.

Active

4-14-00-01273 (Beilstein Handbook Reference). 4-amino-2-Chlorobenzoate ... NCI60_030812. neo Artrol. NINDS_000804. novo Flurprofen. novo-Flurprofen.

Active

10 Jun 2020 ... ... (3) Genes that code for checkpoint control proteins trigger cell cycle stagnation ... in the transcriptional activation area of the N-terminal domain and the ... Target Ther 5, 90 (2020). https://doi.org/10.1038/s41392-020-0196-9.

Active

mosomal somatic cell hybrid panel (Bios Laboratories; code #SCB- ... amygdaloid nucleus; LM = lateral mammillary nucleus; AHi = amygdalohippocampal area; ...

Active

... REVIEWED AB505429;AB505430;AC091842;AF062649;AF075242;AF095287 ... AAB82299;AAC39534;AAG17208;AAG17215;AAH08280;ABQ01233 ...

Active