Array Design Name Keck Glycine max 18kA cDNA Prints101-108 ...

Array Design Name Keck Glycine max 18kA cDNA Prints101-108 ... - Related Phones

... Gm17962cDNA18kA AW507958;BE823962 Gm18070cDNA18kA AW568478 ... Gm01696cDNA18kA AI461244;AW349528 Gm01792cDNA18kA AI441563 ...

Active

... IMAGE:1501914 AA886421;AI733051;AI791541 775 IMAGE:278375 N64010 ... AA773608 18307 IMAGE:278516 N62817;W01352 18308 IMAGE:586990 ...

Active

... 528307 Hs.528307 4 1 14 10 PMHS10k01622 T69563 Experimental 424099 ... 6 2 18 PMHS10k10130 AA489244 Experimental 371166 Hs.371166 2 6 3 18 ...

Active

... H29186 10027 BM471930 10028 BE304565 10029 R20384 10030 R19879 ... W16535 12666 BM454839 12667 W07847 12668 W07759 12669 W02588 ...

Active

... NM_018393 IMAGE:147593 IMAGp998N15230 H01267;H01178;BX114131 ... IMAGp998J18262 H25907;H25906;BX090014;AI820783;AI668608 ...

Active

... AA994760 PM10k00301 AI688443 PM10k00302 AI668800 PM10k00303 ... PM10k01462 AA485362 PM10k01463 AA043996 PM10k01464 AA071330 ...

Active

... T98616 122178 Experimental 3 1 5 9 R01257 R01257 124155 Experimental ... T95274 Hs.448616 120162 Experimental 2 2 12 11 N74915 339324 N74915 ...

Active

... 13 344194 344194 W69924 Experimental 1 12 8 7 754101 754101 BX112438 ... 149967 H01273 PDCD2 Experimental 1 4 2 8 1526943 1526943 BX107840 ...

Active

... 10 29 11 HSI132E11 46438 BX095846 IMAGp998L01273 Experimental 2 10 ... 12 24 6 HSI062E12 359024 BX091478 IMAGp998E09825 Experimental 2 12 ...

Active

... BU528779.1 FL01751 Melo13:P18 CA397499.1 FL01772 Melo12:L06 BF434065.1 ... Meli07:K07 BQ437880.1 FL12064 Meli07:O07 BM802067.1 FL12067 ...

Active

... 21 13 HSI158A02 344194 BX103911 IMAGp998K11786 Experimental 2 4 22 ... 10 19 11 HSI132E11 46438 BX095846 IMAGp998L01273 Experimental 2 10 ...

Active

... IMAGE:289337 910 M58597 IMAGE:133213 911 BC010023 IMAGE:897497 ... NM_002417 IMAGE:769513 7515 L01664 IMAGE:127974 7516 BC004376 ...

Active
Active

... 3 4 306885:Reporter H01422 Experimental 35 9 3 5 306885:Reporter H01422 ... 16 2 4 303323:Reporter AF083810 Experimental 17 16 2 5 303323:Reporter ...

Active

Reporter 430171 286122 AA010252 UniGeneID:Hs.211038/MAGE. ... 1654 1 8 6 10 112814/MAGE.Reporter 124139 R01246 UniGeneID:Hs.298160/MAGE.

Active

... NM_145251P01202 NM_145251 TGGACTTGCAAAGAGGTATTATTGCAATAATGCACTTTTCATACTTGAAATTTATTTGTA BC022465P01738 BC022465 ...

Active

... NB:1100.m01327 NB:1100.m01328 NB:1100.m01329 NB:1100.m01330 ... TC227088 TC227090 TC227091 TC227092 TC227094 TC227101 TC227102 ...

Active

17 Jul 2013 ... ... 311991_0368_3702P00087 GATCATCGTTTTCTAGTTTGGTGAAGCGTCGCGTTGAAGGCACACCGTCGTGCTCCATTC ...

Active

... AV768600 GE19328 TTAGACACTCAAAAAGGGTGGGAGACTAGCATATTAAGGAGCAAACTTTAAACGTAATTC BP033657;BP055338;BP053127 GE19329 ...

Active

... AM956304 SAPD08603_1 CCGTACGCCCCCGGGAGCAAACTCTTCTACAACAAACACTAGCTGACAGAAAAACACAAA AM976398 SAPD01603_2 ...

Active

... EMPV1_01602 unmapped GCAGCCTCCAGGACCCTGGCCCCTGTCAAGCCTGGCAGCAAGTGGAGCAGCAGCTGGGTG EMPV1_01603 unmapped ...

Active

... gnf1m00648_a_at BC011486 gnf1m16822_at BU850357 gnf1m16823_a_at ... (Pms2), mRNA gnf1m01603_a_at Mouse paired-like homeobox 2a (Phox2a), ...

Active

... 114268_2_1_sc127_32388-34034_pP01484 ... 242987_4_1_sc23_699062-699223_pP00087 ...

Active

... NM_126763 AT2G07729.1 AT2G07730.1 AT2G07731.1 AT2G07732.1 AT2G07733.1 ... AT5G23740.1 NM_122279 AT5G23750.1 NM_122280 AT5G23760.1 ...

Active

A1_at BAB01480.1 PtpAffx.12873.1.A1_at CV242873 A9P991 PtpAffx.12873.1. ... S1_s_at DN484805 PtpAffx.26075.1.S1_s_at NP_001060730 PtpAffx.3906.2.

Active

... 5643 ciad055p03 BP013199 5644 citbx01372 AV678534 5645 cits046p22 ... 5888 cieg024l08 AK114844 5889 cilv061k05 BW240053 5890 cicl051m23 ...

Active

... 6 016b18 H54314 203040 IMAGp998B01392 Experimental 2 7 11 6 016f06 ... 3 8 24 19 055o17 AA504243 825045 IMAGp998N222038 Experimental 3 8 1 ...

Active

... R01161 1339826 R01767 1339827 R01904 1339828 R02261 1339829 R02317 ... AA725903 1348023 AA732233 1348024 AA732249 1348025 AA732453 ...

Active

S1_at NM_174205.1 P01223 Bt.475.1.S1_at Bt.475 NM_174205 281552 ENSBTAG00000006295 ... A1_at CB425895 Bt.21487.1.A1_at Bt.90211 Bt.21376.1.

Active

... CE26339 188374_s_at ZK380.1 Q9TZL0 NP_508308 188374_s_at C36C9.2 ... CE37192 181866_at ZC581.3 O01772 IPR000719 AAB54140 181866_at ...

Active

... Experimental 1 1 113 1299 5771_0113_1299 Control control_unknown_type 1 1 115 1299 ... Experimental 1 1 493 1339 5771_0493_1339 ...

Active

A1_at AL914810 IPR001440 CAG07707 Dr.12730.1.A1_at Q64HS6 393410 ... A1_at Q6PBR2 402881 Dr.14768 Dr.25513.1.A1_at BI840774 Dr.25513.1.

Active

... 7tm_3 PR01223 1449897_a_at 1455710_x_at 1425753_a_at 1420539_a_at ... NM_008112 GDI d1d5ta2 PR00044 5.4.99.9 1420815_at AI790193 Q9R274 ...

Active

... Experimental 1 1 333 1013 5758_0333_1013 ... Experimental 1 1 333 1029 5758_0333_1029 ... Experimental 1 1 338 1020 5758_0338_1020 ...

Active

... 4 1 18 17 116d24 47452 H11557 IMAGp998C01276 Experimental 4 1 19 17 ... 093i11 2271075 AI802149 IMAGp998J045623 Experimental 1 2 22 9 093i23 ...

Active

... Experimental 1 1 35 8 220244 At5g01335 CATMA5a00400 ... Experimental 2 11 41 6 216873 At2g44745 CATMA2a43200 ...

Active

... H54314 203040 IMAGp998B01392 Experimental 1 7 11 22 016f06 H56033 ... 3 055o17 AA504243 825045 IMAGp998N222038 Experimental 4 8 1 4 053d05 ...

Active

1 Sep 2012 ... ... AJ564973.1 SNOWBALL_027042_st AJ564974.1 SNOWBALL_027041_s_st ... SNOWBALL_009852_st PF01603 ENSSSCG00000001654 ...

Active

... 302220_A AF228603 AAH01226 ENSG00000100558 NM_016445 3 7 6 10 ... 214279_A D43636 Q14706 ENSG00000163788 2 8 14 6 230500_A ...

Active

... GT_Mm_44k_01244 NM_001159907 unmapped ... GT_Mm_44k_52_P634447 NM_021429 unmapped ...

Active

... CA473763 mwgzebrafish#01471 AI641308 mwgzebrafish#01472 BC044367 ... BM280150 mwgzebrafish#07646 BG306743 mwgzebrafish#07647 ...

Active

... AK006472P01895 CTCAGAGCTTCTCCCGGAAAGAACAGCGAGGCGAGCAGTGGGGAGGCTGCGAAGGACGAA AK006472P01956 ...

Active

... Q9Z246 9444 IPR004087 Hs.15020 212264_s_at rc_AI030030_at D87450.1 ... rc_AA875133_at AI269117 Q9Y400 25983 Hs.9043 213795_s_at L01702_at ...

Active

... UT01202 NM_026002 GCGTGGCCATGTCAGAGTTCTCCAACTGCATTATACCTATACCCTAAATTGAGAAACAAACAGTTGAGAG UT01203 ...

Active

... 5218 Hs.430742 (Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) ... S1_AT NM_021964 ENSG00000114514 7707 601897 Hs.380334 ...

Active

... ENSG00000165917 Z34897_at Z34897 Z34897_at AAN01269 IPB000276 ... X17059_s_at D90070_s_at D90070 1418203_at Q13794 604959 11276046 ...

Active

... E_POPLARS01481P010364 CTCACCACCTCGATGCCGACGATAACGTGATGGATGTCTCACCTGAAATCACCAAGTCGG E_POPLARS01482P010369 ...

Active

CompositeSequence CAC01452.1 SCO1228 putative acyltransferase 2 3 5 26 ... SCO7780 putative transcriptional regulator 4 2 5 15 379104/MAGE.Reporter ...

Active

... 2557 208470_s_at X01792 GO:0004252 ENSG00000197711 NM_020995 ... AL139286 GO:0005850 ENSG00000092847 Hs.22867 NM_012199 606228 ...

Active

... 1460723_at Q8JGW1 ENSRNOG00000016685 PR01527 729997 Rn.9673 ... Q9H6U3 Rn.33594 BF419134 1389116_at W68255_at Q8K3W5 Rn.20978 ...

Active

S1_at AK100732.1 Os.2916.1.S1_at AAK53826 Os.6672.1.S1_at AK068117.1 Os.6672.1. ... S1_at BAB01202.1 Os.21863.1.S1_at AK061658.1 Os.21863.1.

Active

... Experimental 1 1 20 50 Ssa#STIR01708 ... 1 1 62 149 ( )E1A_r60_n11 Control control_spike_calibration 1 1 63 149 Omy#BX871884 BX871884 ...

Active

... AK095384 AK095407P01558 AK095407 AK095409P01253 AK095409 ... XM_928083 XM_928085P01899 XM_928085 XM_928088P00363 XM_928088 ...

Active

25 May 2011 ... ... Experimental 1 1 8 79 Ssa#DY738785 ... Experimental 1 1 11 182 Ssa#STIR01539 ...

Active

... AI800348 AI800348 AI801503 AI801503 AI801869 AI801869 AI802386 AI802386 ... ASLNC01240 ASLNC01241 ASLNC01242 ASLNC01243 ASLNC01244 ...

Active

... CK957083 bt00008242 GCCGCCAAGGATTATTGTGCCACGAAGTGGTCGATCCTGCGGGAACGCTTTGACCGAGGACTGTATGCCT CK957060 bt00008227 ...

Active

... AW804939 Experimental 1 1 325 26 A_23_P142518 ... NM_021029;NM_001101383 Experimental 1 1 117 33 A_01_V01895 ...

Active

... AFLA_087730 2504.m01482_at AFLA_087740 2504.m01483_at ... TC293957_ZM_at TC293966_ZM_at TC293966_ZM_x_at TC293967_ZM_at ...

Active

... Experimental 1 1 81 791 6918_0081_0791 ... Experimental 1 1 429 855 6918_0429_0855 ... Control control_unknown_type 1 1 19 845 6918_0019_0845 ...

Active

... AK088379;BC010985;U14412 TGAGCGTGATCTCGCCTCCATCATGAAGAAGCTCTTGACCAAGTACGACAATCTATTTGA 22550 AK004196;AK034669 ...

Active