Array Design Name UF Nimblegen Populus trichocarpa Array ...

Array Design Name UF Nimblegen Populus trichocarpa Array ... - Related Phones

... E_POPLARS01481P010364 CTCACCACCTCGATGCCGACGATAACGTGATGGATGTCTCACCTGAAATCACCAAGTCGG E_POPLARS01482P010369 ...

Active

... NM_145251P01202 NM_145251 TGGACTTGCAAAGAGGTATTATTGCAATAATGCACTTTTCATACTTGAAATTTATTTGTA BC022465P01738 BC022465 ...

Active

... 114268_2_1_sc127_32388-34034_pP01484 ... 242987_4_1_sc23_699062-699223_pP00087 ...

Active

... NM_126763 AT2G07729.1 AT2G07730.1 AT2G07731.1 AT2G07732.1 AT2G07733.1 ... AT5G23740.1 NM_122279 AT5G23750.1 NM_122280 AT5G23760.1 ...

Active

... AK006472P01895 CTCAGAGCTTCTCCCGGAAAGAACAGCGAGGCGAGCAGTGGGGAGGCTGCGAAGGACGAA AK006472P01956 ...

Active

... AI800348 AI800348 AI801503 AI801503 AI801869 AI801869 AI802386 AI802386 ... ASLNC01240 ASLNC01241 ASLNC01242 ASLNC01243 ASLNC01244 ...

Active

... NM_025961P01128 NM_025961 ATCCAAATGGCTTTCCATGAACGTCTTAATGCTAGATGAGAAGCGCGTGATGGTAGATGC AF080090P01925 AF080090 ...

Active

... AK147204 AK147204P07718 TCTCCAGGGAGGTGGTTATTATCAAGCTGACCCAAAGGAGTGCAGTATGTGTTCTAGTTC AK147204 AK147204P07827 ...

Active

... AJ897538 L03T34P070R06600 AJ897546 L03T34P071R06612 AJ897552 ... AJ915587 L53TP1P021R01943 AJ915588 L53TP1P021R01945 AJ915590 ...

Active

... AJ897538 L03T34P070R06600 AJ897546 L03T34P071R06612 AJ897552 ... AJ915587 L53TP1P021R01943 AJ915588 L53TP1P021R01945 AJ915590 ...

Active

... JW201489 F5A5JTJ01B052ZP00100 JW214226 F5A5JTJ01B052ZP00221 JW214226 ... GmE100215i01733P00001 JW198288 GmE100215i01733P00753 ...

Active

... PUT_163A_ZEA_MAYS_04199 PUT_163A_ZEA_MAYS_042221 GRMZM2G050748_T01 AC208835_2_FGENESH_11 PUT_163A_ZEA_MAYS_067957 ...

Active

... AF229803P00574 GCATGGCTCCTCTGGTACAGAATGCTCTTCCTTAAAAACCTTGATGGCTGAAATGTCCTG AF229803P01324 ...

Active
Active

... IMAGE:1501914 AA886421;AI733051;AI791541 775 IMAGE:278375 N64010 ... AA773608 18307 IMAGE:278516 N62817;W01352 18308 IMAGE:586990 ...

Active

... AV768600 GE19328 TTAGACACTCAAAAAGGGTGGGAGACTAGCATATTAAGGAGCAAACTTTAAACGTAATTC BP033657;BP055338;BP053127 GE19329 ...

Active

... 3 4 306885:Reporter H01422 Experimental 35 9 3 5 306885:Reporter H01422 ... 16 2 4 303323:Reporter AF083810 Experimental 17 16 2 5 303323:Reporter ...

Active

Reporter 430171 286122 AA010252 UniGeneID:Hs.211038/MAGE. ... 1654 1 8 6 10 112814/MAGE.Reporter 124139 R01246 UniGeneID:Hs.298160/MAGE.

Active

17 Jul 2013 ... ... 311991_0368_3702P00087 GATCATCGTTTTCTAGTTTGGTGAAGCGTCGCGTTGAAGGCACACCGTCGTGCTCCATTC ...

Active

... NB:1100.m01327 NB:1100.m01328 NB:1100.m01329 NB:1100.m01330 ... TC227088 TC227090 TC227091 TC227092 TC227094 TC227101 TC227102 ...

Active

... R01161 1339826 R01767 1339827 R01904 1339828 R02261 1339829 R02317 ... AA725903 1348023 AA732233 1348024 AA732249 1348025 AA732453 ...

Active

S1_at NM_174205.1 P01223 Bt.475.1.S1_at Bt.475 NM_174205 281552 ENSBTAG00000006295 ... A1_at CB425895 Bt.21487.1.A1_at Bt.90211 Bt.21376.1.

Active

... Experimental 1 1 113 1299 5771_0113_1299 Control control_unknown_type 1 1 115 1299 ... Experimental 1 1 493 1339 5771_0493_1339 ...

Active

... H29186 10027 BM471930 10028 BE304565 10029 R20384 10030 R19879 ... W16535 12666 BM454839 12667 W07847 12668 W07759 12669 W02588 ...

Active

... 6 016b18 H54314 203040 IMAGp998B01392 Experimental 2 7 11 6 016f06 ... 3 8 24 19 055o17 AA504243 825045 IMAGp998N222038 Experimental 3 8 1 ...

Active

A1_at BAB01480.1 PtpAffx.12873.1.A1_at CV242873 A9P991 PtpAffx.12873.1. ... S1_s_at DN484805 PtpAffx.26075.1.S1_s_at NP_001060730 PtpAffx.3906.2.

Active

... GT_Mm_44k_01244 NM_001159907 unmapped ... GT_Mm_44k_52_P634447 NM_021429 unmapped ...

Active

1 Sep 2012 ... ... AJ564973.1 SNOWBALL_027042_st AJ564974.1 SNOWBALL_027041_s_st ... SNOWBALL_009852_st PF01603 ENSSSCG00000001654 ...

Active

A1_at AL914810 IPR001440 CAG07707 Dr.12730.1.A1_at Q64HS6 393410 ... A1_at Q6PBR2 402881 Dr.14768 Dr.25513.1.A1_at BI840774 Dr.25513.1.

Active

... CA473763 mwgzebrafish#01471 AI641308 mwgzebrafish#01472 BC044367 ... BM280150 mwgzebrafish#07646 BG306743 mwgzebrafish#07647 ...

Active

... gnf1m00648_a_at BC011486 gnf1m16822_at BU850357 gnf1m16823_a_at ... (Pms2), mRNA gnf1m01603_a_at Mouse paired-like homeobox 2a (Phox2a), ...

Active

... AM956304 SAPD08603_1 CCGTACGCCCCCGGGAGCAAACTCTTCTACAACAAACACTAGCTGACAGAAAAACACAAA AM976398 SAPD01603_2 ...

Active

... 528307 Hs.528307 4 1 14 10 PMHS10k01622 T69563 Experimental 424099 ... 6 2 18 PMHS10k10130 AA489244 Experimental 371166 Hs.371166 2 6 3 18 ...

Active

... 4 1 18 17 116d24 47452 H11557 IMAGp998C01276 Experimental 4 1 19 17 ... 093i11 2271075 AI802149 IMAGp998J045623 Experimental 1 2 22 9 093i23 ...

Active

... 7tm_3 PR01223 1449897_a_at 1455710_x_at 1425753_a_at 1420539_a_at ... NM_008112 GDI d1d5ta2 PR00044 5.4.99.9 1420815_at AI790193 Q9R274 ...

Active

... Experimental 1 1 35 8 220244 At5g01335 CATMA5a00400 ... Experimental 2 11 41 6 216873 At2g44745 CATMA2a43200 ...

Active

... H54314 203040 IMAGp998B01392 Experimental 1 7 11 22 016f06 H56033 ... 3 055o17 AA504243 825045 IMAGp998N222038 Experimental 4 8 1 4 053d05 ...

Active

... Experimental 1 1 333 1013 5758_0333_1013 ... Experimental 1 1 333 1029 5758_0333_1029 ... Experimental 1 1 338 1020 5758_0338_1020 ...

Active

... 302220_A AF228603 AAH01226 ENSG00000100558 NM_016445 3 7 6 10 ... 214279_A D43636 Q14706 ENSG00000163788 2 8 14 6 230500_A ...

Active

... CE26339 188374_s_at ZK380.1 Q9TZL0 NP_508308 188374_s_at C36C9.2 ... CE37192 181866_at ZC581.3 O01772 IPR000719 AAB54140 181866_at ...

Active

... 5643 ciad055p03 BP013199 5644 citbx01372 AV678534 5645 cits046p22 ... 5888 cieg024l08 AK114844 5889 cilv061k05 BW240053 5890 cicl051m23 ...

Active

... EMPV1_01602 unmapped GCAGCCTCCAGGACCCTGGCCCCTGTCAAGCCTGGCAGCAAGTGGAGCAGCAGCTGGGTG EMPV1_01603 unmapped ...

Active

... Q9Z246 9444 IPR004087 Hs.15020 212264_s_at rc_AI030030_at D87450.1 ... rc_AA875133_at AI269117 Q9Y400 25983 Hs.9043 213795_s_at L01702_at ...

Active

... 2557 208470_s_at X01792 GO:0004252 ENSG00000197711 NM_020995 ... AL139286 GO:0005850 ENSG00000092847 Hs.22867 NM_012199 606228 ...

Active

... NM_018393 IMAGE:147593 IMAGp998N15230 H01267;H01178;BX114131 ... IMAGp998J18262 H25907;H25906;BX090014;AI820783;AI668608 ...

Active

... UT01202 NM_026002 GCGTGGCCATGTCAGAGTTCTCCAACTGCATTATACCTATACCCTAAATTGAGAAACAAACAGTTGAGAG UT01203 ...

Active

... 1460723_at Q8JGW1 ENSRNOG00000016685 PR01527 729997 Rn.9673 ... Q9H6U3 Rn.33594 BF419134 1389116_at W68255_at Q8K3W5 Rn.20978 ...

Active

... ENSG00000165917 Z34897_at Z34897 Z34897_at AAN01269 IPB000276 ... X17059_s_at D90070_s_at D90070 1418203_at Q13794 604959 11276046 ...

Active

CompositeSequence CAC01452.1 SCO1228 putative acyltransferase 2 3 5 26 ... SCO7780 putative transcriptional regulator 4 2 5 15 379104/MAGE.Reporter ...

Active

... 5218 Hs.430742 (Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) ... S1_AT NM_021964 ENSG00000114514 7707 601897 Hs.380334 ...

Active

S1_at AK100732.1 Os.2916.1.S1_at AAK53826 Os.6672.1.S1_at AK068117.1 Os.6672.1. ... S1_at BAB01202.1 Os.21863.1.S1_at AK061658.1 Os.21863.1.

Active

... AK095384 AK095407P01558 AK095407 AK095409P01253 AK095409 ... XM_928083 XM_928085P01899 XM_928085 XM_928088P00363 XM_928088 ...

Active

25 May 2011 ... ... Experimental 1 1 8 79 Ssa#DY738785 ... Experimental 1 1 11 182 Ssa#STIR01539 ...

Active

... Experimental 1 1 20 50 Ssa#STIR01708 ... 1 1 62 149 ( )E1A_r60_n11 Control control_spike_calibration 1 1 63 149 Omy#BX871884 BX871884 ...

Active

... AK088379;BC010985;U14412 TGAGCGTGATCTCGCCTCCATCATGAAGAAGCTCTTGACCAAGTACGACAATCTATTTGA 22550 AK004196;AK034669 ...

Active

... AFLA_087730 2504.m01482_at AFLA_087740 2504.m01483_at ... TC293957_ZM_at TC293966_ZM_at TC293966_ZM_x_at TC293967_ZM_at ...

Active

... AW804939 Experimental 1 1 325 26 A_23_P142518 ... NM_021029;NM_001101383 Experimental 1 1 117 33 A_01_V01895 ...

Active

... CK957083 bt00008242 GCCGCCAAGGATTATTGTGCCACGAAGTGGTCGATCCTGCGGGAACGCTTTGACCGAGGACTGTATGCCT CK957060 bt00008227 ...

Active

... Experimental 1 1 81 791 6918_0081_0791 ... Experimental 1 1 429 855 6918_0429_0855 ... Control control_unknown_type 1 1 19 845 6918_0019_0845 ...

Active

... P01895;P01899;P01900;P14426;P14427 ... 9643 AF003333;AF057544;AF137621;AF144962;AF206022;AF423750;AY081858;M12190;M12751;M32765 ...

Active