PromBase - Genome Information
553001. 553444. 444. . PROTEIN:hypothetical protein. SARI_00557 ... SARI_01733. SARI_01733. 1663497. 1663622. 126. -. PROTEIN:putative lipoprotein ...
PromBase - Genome Information - Related Phones
553001. 553444. 444. . PROTEIN:hypothetical protein. SARI_00557 ... SARI_01733. SARI_01733. 1663497. 1663622. 126. -. PROTEIN:putative lipoprotein ...
15 Jun 2012 ... 293966. 1170. . PROTEIN:metal-dependent peptidase ... . PROTEIN:Thiol-disulfide isomerase or thioredoxin. LCK_01482. LCK_01482 ...
219. . PROTEIN:hypothetical protein. Mext_0191. Mext_0191. 205569. 207266. 1698 ... Mext_2220. 2464810. 2465061. 252. -. PROTEIN:hypothetical protein ...
amb0333. amb0333. 371924. 372250. 327. -. PROTEIN:anti-anti-sigma regulatory factor ... 3219790. 1182. . PROTEIN:major facilitator superfamily permease ...
15 Jun 2012 ... PROTEIN:Pyrrolo-quinoline quinone. Huta_0161. Huta_0161. 162570. 163385 ... 3025898. 810. -. PROTEIN:hypothetical protein. Huta_2938 ...
15 Jun 2012 ... 310737. 312158. 1422. -. PROTEIN:hypothetical protein ... PROTEIN:RND superfamily drug exporter. cpfrc_01949. cpfrc_01949. 2144878 ...
Mhun_0800. Mhun_0800. 913353. 914108. 756. . PROTEIN:glutamine amidotransferase class-I ... 1560131. 1561711. 1581. . PROTEIN:UvrD/REP helicase ...
... TetR family transcriptional regulator; AA105_07480, 0.0, Showinfo_outline ... Phage protein, phage(gi658307803), PHAGE_Strept_IC1_NC_024370
... 46" P12994 Protein ybhB b0773 UNC 0.28 808480 REC04623 bioA N 429 ... oligopeptide-binding protein precursor b1243 MTR 0.72 1300923 REC01204 ...
23 Mar 2020 ... ... for wood decay, latex tolerance and interspecific fungal interactions. Sci Rep 10, 5250 (2020). https://doi.org/10.1038/s41598-020-62150-4.
... d1ky3a_ 619805 NM_053972 ENSRNOG00000003160 Q63487 1369697_at ... d1nezg_ 2316 NM_031538 ENSRNOG00000007178 P07725 1369878_at ...
8 Oct 2019 ... ... 38.6, 447,960, 37.0, 420,672, 36.5, 456,019, 36.2, 425,717, 33.2, 610,348 ... ClassII//DNA_nMITE/EnSpm, 7,489, 7,513, 7,500, 7,470, 7,505 ...
Growth was measured as area under the growth curve (AUC) in order to capture ... was assembled using a combination of in-house code and GDtools part of the ... material for this article may be found at https://doi.org/10.1128/AAC.01619-19.
CPn0483 561836 564964 F. CPn0484 564970 565824 F aroG-Deoxyheptonate λldolase- (CT382). CPn0485 566038 566229 F CT382.1 hypothecical procein.
4.44E-13. 0.966575. Adiponectin. 3. 186561692. 0.99921. 0.05868. 0.02693 ... 3.32E-17. 0.966315. Adiponectin. 3. 158915408. 2.39489. 0.50728. 0.00045.
... Panos Deloukas, Daniel J Rader, John Danesh, Dharambir K Sanghera ... Bert Bravenboer, Suzannah Bumpstead, Noël P Burtt, Guillaume Charpentier, Peter ...
... ENSG00000161677 PR01233 13384740 NM_138334 Josephin Hs.116708 126119 ... 243150_at 243151_at BG438112 243151_at Hs.186776 243152_at ...
... BI511663 AM01924 BI511682 AM01925 BI511705 AM01926 BI511714 ... AM10705 XM_392888.3 AM10706 XM_394082.3 AM10707 XM_625041.2 ...
... 33461 CG3127-RA Q01604 1628991_at IPR001993 1628991_at NP_609093 ... FBgn0037547 Q9VHW0 1632759_at IPR001012 1632759_at XP_310708 ...
all international parcels EU and Worldwide. Booking Tel: 0844 248 0844 (also for quotations) Account Manager: Jake Dodds Email: [email protected]
... 34589_f_at 2107 U01908cds_s_at U01908 U01908cds_s_at U02320_s_at ... NM_032083 RhoGAP 112851_at 620139 rc_AA894330_s_at P15791 24246 ...
S0161. map. 179143. 179937. 795. -. PROTEIN:methionine aminopeptidase ... 2350486. 1629. . PROTEIN:sn-glycerol-3-phosphate dehydrogenase subu ...
... 258540_at At3g06990 DC1 IPB001169 258541_at 258541_at At3g07000 DC1 ... 255554_at At4g01895 255555_at 255555_at At4g01810 Sec23_Sec24 ...
... 1097682 20103 1416055_at NM_009669 V01225MRNA_S_AT NP_004029 ... 1425268_a_at BB752266 1382053_AT NP_690012 NM_028460 Q8CGA7 ...
... 69921 aa537455_s_at 1917171 aa537455 aa537500_s_at O35425 51800 ... ENSMUSG00000021771 V01274_at 106915 6755965 U30838 NM_011695 ...
1980;208:990–1000. 10. Jetter R, Schäffer S. Chemical composition of the Prunus laurocerasus leaf surface. Dynamic changes of the epicuticular wax film during ...
... PUT_163A_ZEA_MAYS_04199 PUT_163A_ZEA_MAYS_042221 GRMZM2G050748_T01 AC208835_2_FGENESH_11 PUT_163A_ZEA_MAYS_067957 ...
91738 gene=IY08_01895 protein=arginine deiminase ... gene 3122976 3123155 106776 106955 gene=IY08_16480 protein=hypothetical protein.
... GT_Mm_44k_01709 ATTCATAGAGTTCCGGGCCTGGGATTCTCCCAGCTGCGCCATAGGTCATCCTCAACAACC NM_026964 GT_Mm_44k_01710 ...
These evidence codes are from the Gene Ontology project. Figure 1 ... Strain BD11-00177 was sequenced because of its relevance to biodefense. The draft ...
5 Nov 2019 ... Site-specific gene regulation is one of the main areas where genome ... Researchers have unveiled the structure of DNA, how DNA codes for ... Exp Mol Med 51, 1–11 (2019). https://doi.org/10.1038/s12276-019-0339-7.
... Hs.156276 ENSG00000106443 85533_r_at H01493 85533_r_at Hs.365162 ... IPR001849 Hs.351676 90302_at AA770016 90302_at Hs.121192 90303_at ...
... ENSG00000137492 33469019 Hs.177574 NM_004705 hATC 607374 5612 ... IPR009058 206577_at NM_003381 206577_at P01282 ENSG00000146469 ...
S1_at X66493.1 Q01707 IPR000209 Xl.1272.1.S1_at AAH74270 Xl.1272 ... A1_at BQ384048 Q7T0Y0 IPR001611 Xl.13119.1.A1_at XP_546742 Xl.13119 ...
... 69725_at AI680862 69725_at Hs.432434 69726_r_at AI683396 69726_r_at ... 4883 IPR001170 IPB001170 4505441 Hs.123655 108962 78085_at R01204 ...
... 8993 4827036 ENSG00000008438 604963 31382_f_at AF016492 O75310 ... Z34897 AAN01269 Hs.1570 NM_000861 7tm_1 35384_at 3269 IPR000921 ...
... IPR003380 PR01228 6681129 Mm.12885 115000_at AA839773 BAC36269 ... ENSMUSG00000030217 114038_at AI648199 Q9D4H1 NM_025588 TIG ...
... 5.3.3.1 Mm.29939 136986_at AV101791 P07759 136986_at 1915688 20714 ... 132501_i_at AV304565 132501_i_at Mm.79944 132502_f_at AV304565 ...
... 42508_at AA620670 Hs.112880 42508_at 42509_at AI669006 Hs.112886 ... Hs.78026 58642_s_at 58644_at AI161015 O75888 IPR006052 PR01234 ...
... NM_015801 IPR002641 CAG01292 ENSMUSG00000004565 NM_015801 ... IPR001810 NP_775615 ENSMUSG00000035764 NM_173439 Mm.256137 ...
... 102630_s_at M16819 P09225 PR01234 ENSMUSG00000024402 7106343 ... Q8JZQ7 Mm.21655 rc_AI235100_at 102058 103456_at AI841800 Mm.21657 ...
... 35384_at Z34897 AAN01269 Hs.1570 NM_000861 7tm_1 1438494_at 3269 ... 11276046 ENSG00000141682 604959 41049_at S62539 P35568 Hs.96063 ...
14 Jan 2020 ... The number of druggable tumor-specific molecular aberrations has grown ... and the rising number of large-scale tumor molecular profiling programs ... Genome Med 12, 8 (2020). https://doi.org/10.1186/s13073-019-0703-1.
... O94921 Hs.430742 NM_012395 3.1.7 204605_at NM_006568 1434565_AT ... IPR003109 205240_at CAG07707 29899 GO:0007186 ENSG00000121957 ...
... CE26339 188374_s_at ZK380.1 Q9TZL0 NP_508308 188374_s_at C36C9.2 ... CE37192 181866_at ZC581.3 O01772 IPR000719 AAB54140 181866_at ...
A1_at BAB01480.1 PtpAffx.12873.1.A1_at CV242873 A9P991 PtpAffx.12873.1. ... S1_s_at DN484805 PtpAffx.26075.1.S1_s_at NP_001060730 PtpAffx.3906.2.
A1_at AL914810 IPR001440 CAG07707 Dr.12730.1.A1_at Q64HS6 393410 ... A1_at Q6PBR2 402881 Dr.14768 Dr.25513.1.A1_at BI840774 Dr.25513.1.
S1_at NM_174205.1 P01223 Bt.475.1.S1_at Bt.475 NM_174205 281552 ENSBTAG00000006295 ... A1_at CB425895 Bt.21487.1.A1_at Bt.90211 Bt.21376.1.
NB:when contacting the trust Switchboard, please identify the placement area you ... Salford hospitals and community services - Salford Royal Hospitals NHS ...
... and mail or fax the completed form to: Center for Health Information Management 4560 Trousdale Drive, Suite 101. Nashville, TN 37204. Fax: (615) 343-0126 ...
Welcome to the website of the India Visa and Consular Service Application Centre in UK. VFS Services (UK) Ltd is a trusted partner to “The Government of India” ...
118 INFORMATION LIMITED - Free company information from Companies House including registered office address, filing history, accounts, annual return, ...
Our group companies are as follows: Market Location Ltd, 118 Group Limited, 118 Information Limited, 118 Data Resource Limited, Elocation, IDS Data Services ...
118 Information Group Ltd. Keeping the UK's Directory Information Up-to-Date. About Us Search our Directory ...
S1_at AK100732.1 Os.2916.1.S1_at AAK53826 Os.6672.1.S1_at AK068117.1 Os.6672.1. ... S1_at BAB01202.1 Os.21863.1.S1_at AK061658.1 Os.21863.1.
SS1 2AP. Universal Credit: 01702 215001. Benefits Enquiries. NI Number Application Line: 0345 600 0643 (Over 20 years old) Monday to Friday 8am – 6pm.
How can a business sort through this enormous dataset to identify consumers, decision on loans, market to prospects and collect? Experian's Consumer ...
Emergency Number: 0800 096 9779. Overseas: 44 170 227 8270. Personal Customers with accounts in UK (24 hours, seven days a week) Emergency ...
Textphone: 0345 835 3843. Textphone Overseas: 44 1733 286 350. Current & Savings Account Customers (24 hours, Seven days a week) UK: 03459 758 758
Q: How can I contact you?