Genes in band 12q24 - Chromosome 12

Genes in band 12q24 - Chromosome 12 - Related Phones

12q24, 12p13, Cosmic_SV, u(12)(q24;p13), Cosmic_SV [COST744194] ... chr12:110936602-110937446 , 12q24, Gene [G], LINC01405 · [Omim] · [Entrez].

Active

12q24, 12p13, Cosmic_SV, u(12)(q24;p13), Cosmic_SV [COST744194] ... chr12:110936602-110937446 , 12q24, Gene [G], LINC01405 · [Omim] · [Entrez].

Active

WHERE THERE'S PIPE, THERE'S MATHEY. Band Crawler & Stainless Steel Band. Part Number: 05-0116-009, 05-0116-014. & 05-0116-M08. Parts and ...

Active

pza01887 · pza01925 · pza02040 · pza02060 · pza02164 · pza02207 · pza02390 · pza02408 · pza02426 · pza02462 · pza02480 · pza02513 · pza02525 ...

Active

The exception to this pattern, however, was X-linked genes that code ... in males, this area is transcriptionally inactive and is hypermethylated.55 Because these.

Active

... chromosome,Prodigal:2.6,CDS,135800,136690,.,-,0,ID=PROKKA_00134 ... chromosome,Prodigal:2.6,CDS,1958405,1958878,.,-,0,ID=PROKKA_01895 ...

Active

24 Dec 2019 ... Int J Androl 34:e642–e648. https://doi.org/10.1111/j.1365-2605.2011.01223.x ... 5:544–553. https://doi.org/10.1016/S2213-8587(16)30040-7.

Active

... rs201711319 13 23910103 AA rs111920492 13 23910487 GG rs78239814 13 23910631 GG rs142249822 1 155039225 CC rs142869943 13 23910850 GG ...

Active

around the Mediterranean area (Cinnio˘gulu et al. ... Population codes are as follows: Madeira-MA, Açores-AC, North Portugal-NP, Centre Portugal-CP, and ...

Active

6 Feb 2020 ... by email: [email protected] or phone: 202-418-0530 or TTY: 202-418-0432. ... 2020-02086 Filed 2-5-20; 8:45 am]. BILLING CODE 6712-01-P ...

Active

14 Nov 2018 ... U2 could be calling it a day, according to a remark Bono made in Berlin last night, on the final stop of their Experience Innocence tour.

Active

Bronwydd House, Cymmer, Porth Conductor: Mr Oliver Jones ​1951. Picture. Lewis Merthyr Band c.1950 / 1951. Conductor: Mr Oliver Jones Photograph ...

Active

Wear Versa family your way. Coral Sport Band. Navy Sport Band Coral Sport Band. Black Sport Band Glacier Sport Band. Navy Sport Band Coral Sport Band.

Active

... Label: 429 Records; ASIN: B0052KJ5XG; Customer Reviews: 3.7 out of 5 stars10 customer ratings; Amazon Best Sellers Rank: #673,914 in CDs & Vinyl (See ...

Active

Usually $159, the MeshForce M3 is a dual-band Wi-Fi router system that includes a primary Wi-Fi point and two plug-in Dots, which look sort of like Wi-Fi extenders but aren't -- they're...

Active

Buy Mathey-Dearman 05-0116-009 Monarch Band Machine W/ 9' Flexible Drive Cable 05.0116.009 at Gas and Supply. Your source for welding, industrial, ...

Active

... andy01227 (Musician in London, EN , N15); tom18241 (Musician in Norwich, ... paul318103 (Musician in Southampton, EN , so17); giles318108 (Musician in ...

Active

2 Jan 2018 ... 14021 - Band E Administration Officer in Avon, North Somerset ... and other offices within Her Majesty's Courts and Tribunals Service (HMCTS).

Active

... BBenway (Musician in Marlborough, MA , 01752); AnnaLisasLaw (Musician in ... starla547410 (Musician in Finksburg, MD , 21048); marisa547425 (Musician ...

Active

2 days ago ... Isle of Wight residents will have to pay more for a new tax for the new combined Hampshire and Isle of Wight Fire Authority from 2021. Islanders ...

Active

Initially, Microsoft only released the out-of-band patch for CVE-2019-1367 on the Microsoft Update Catalog , which users needed to manually download. 

Active

I've been equally impressed with products like the $20 , $20 Wyze Scale and $8 Wyze Bulb . (Order each via Amazon or Wyze.com, and you'll pay about $4 to $10 extra for shipping.)

Active

10 Feb 2010 ... (800) 206-4856 www.billhornmusic.com www.8bands.com. Loading... Autoplay When autoplay is enabled, a suggested video will automatically ...

Active

These include the latest feature release, Windows 10, version 2004, as well as the older version 1709, version 1607, Windows 10 Enterprise LTSC 2015, and Windows 8.1. Also affected are...

Active
Microsoft releases out-of-band security update to fix IE zero-day All help you need! 1367 ! All in one place!</a></div> <div class="link"> <a href="/num/9203a8d/microsoft-releases-out-of-band-security-update-to-fix-ie-zero-day-/url-title-all-help-you-need!-1367 !-all-in-one-place!">https://www.zdnet.com/article/microsoft-releases-out-of-band-security-update-to-fix-ie-zero-day-defender-bug/</a> </div> <p>HelpWire is the ultimate one-stop shop for people of all expertise levels looking for help on all kind of topics -- tech, shopping and more.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/9203a8d/microsoft-releases-out-of-band-security-update-to-fix-ie-zero-day-/url-title-all-help-you-need!-1367 !-all-in-one-place!" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.mrfix.ua/garmin-fenix-5x-slate-gray-sapphire-with-black-band-010-01733-00/"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/c68c3c7/garmin-fenix-5x-slate-gray-sapphire-with-black-band-(010-01733-00)">Garmin Fenix 5X Slate Gray Sapphire with Black Band (010-01733-00)</a></div> <div class="link"> <a href="/num/c68c3c7/garmin-fenix-5x-slate-gray-sapphire-with-black-band-(010-01733-00)">https://www.mrfix.ua/garmin-fenix-5x-slate-gray-sapphire-with-black-band-010-01733-00/</a> </div> <p>Покупай Garmin Fenix 5X Slate Gray Sapphire with Black Band (010-01733-00) на MrFix.ua ✓ Работаем с 2010 года ✓ Магазин в центре Киева ✓ Свой ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/c68c3c7/garmin-fenix-5x-slate-gray-sapphire-with-black-band-(010-01733-00)" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.fotosklad.ru/catalog/fitnes-braslet-huawei-honor-color-band-a2-seryy-203318.html"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/46c78b/Фитнес-браслет-honor-color-band-a2-серый-купить-в-интернет-">Фитнес браслет Honor Color Band A2, серый купить в интернет ...</a></div> <div class="link"> <a href="/num/46c78b/Фитнес-браслет-honor-color-band-a2-серый-купить-в-интернет-">https://www.fotosklad.ru/catalog/fitnes-braslet-huawei-honor-color-band-a2-seryy-203318.html</a> </div> <p>... оформлении заказа нужно выбрать службу доставки с пометкой Скидка на товар. Заказ будет выслан напрямую от поставщика. Код товара: 203318.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/46c78b/Фитнес-браслет-honor-color-band-a2-серый-купить-в-интернет-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.cell.com/cms/10.1016/j.cmet.2012.06.006/attachment/8817e053-1252-40e8-b407-927258b0acab/mmc1.pdf"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/2e81016/the-top-20-genes-in-ranking">The top 20 genes in ranking</a></div> <div class="link"> <a href="/num/2e81016/the-top-20-genes-in-ranking">https://www.cell.com/cms/10.1016/j.cmet.2012.06.006/attachment/8817e053-1252-40e8-b407-927258b0acab/mmc1.pdf</a> </div> <p>G6PC2_rs560887. 3,50E-07 ... G6PC2_rs560887. 1,11E-06 ... 1,942. 0,000001. SERPINF1 serpin peptidase inhibitor, clade F (alpha-2 antiplasmin). 7968199 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/2e81016/the-top-20-genes-in-ranking" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.genecards.org/cgi-bin/cardlist.pl"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/48428/genes-genecards">Genes - GeneCards</a></div> <div class="link"> <a href="/num/48428/genes-genecards">https://www.genecards.org/cgi-bin/cardlist.pl</a> </div> <p>... LINC01208 · LINC01209 · LINC01210 · LINC01213 · LINC01214 · LINC01215 · LINC01216 · LINC01217 · LINC01218 · LINC01219 · LINC01220 · LINC01221 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/48428/genes-genecards" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://mbio.asm.org/content/mbio/10/5/e02253-19/DC2/embed/inline-supplementary-material-2.xlsx?download=true"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/2ec668/s1a-tts-associated-with-genes-mbio">S1A - TTS associated with genes - mBio</a></div> <div class="link"> <a href="/num/2ec668/s1a-tts-associated-with-genes-mbio">https://mbio.asm.org/content/mbio/10/5/e02253-19/DC2/embed/inline-supplementary-material-2.xlsx?download=true</a> </div> <p>858, PA0844, 919258, 921450, -, hemolytic phospholipase C, NA, NA, NA, 1 ... 2286, PA2253, 2480844, 2481830, , L-asparaginase I, NA, NA, NA, 1, 1550.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/2ec668/s1a-tts-associated-with-genes-mbio" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.cnet.com/news/gofundme-campaign-raises-money-to-send-mariachi-band-taco-truck-to-racist-nyc-lawyer/"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/38ecda6/gofundme-campaign-raises-money-to-send-mariachi-band-taco-truck-to-racist-nyc-">GoFundMe campaign raises money to send Mariachi band, taco truck to racist NYC...</a></div> <div class="link"> <a href="/num/38ecda6/gofundme-campaign-raises-money-to-send-mariachi-band-taco-truck-to-racist-nyc-">https://www.cnet.com/news/gofundme-campaign-raises-money-to-send-mariachi-band-taco-truck-to-racist-nyc-lawyer/</a> </div> <p>Followers of the account apparently liked the idea and put the call into action.Mark Goldberg launched a GoFundMe campaign to raise money for the band, which is slated to play the song,...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/38ecda6/gofundme-campaign-raises-money-to-send-mariachi-band-taco-truck-to-racist-nyc-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.mdpi.com/2073-4344/8/3/117/s1"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/19b6c9/s1-annotated-genes-mdpi">S1 Annotated Genes - MDPI</a></div> <div class="link"> <a href="/num/19b6c9/s1-annotated-genes-mdpi">https://www.mdpi.com/2073-4344/8/3/117/s1</a> </div> <p>620, pgap, AYM39_02980, 653059, 653733, -, 4, girp, 675, 0, 653059, hypothetical ... protein|][proka|PROKKA_01636||Phage Tail Collar Domain protein|].</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/19b6c9/s1-annotated-genes-mdpi" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="http://journals.plos.org/plosone/article/file?type=supplementary&id=info%3Adoi%2F10.1371%2Fjournal.pone.0162363.s004"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/71c0b3/yali1-genes-plos">YALI1 Genes - PLoS</a></div> <div class="link"> <a href="/num/71c0b3/yali1-genes-plos">http://journals.plos.org/plosone/article/file?type=supplementary&id=info%3Adoi%2F10.1371%2Fjournal.pone.0162363.s004</a> </div> <p>295, YALI0A06237r, YALI1_A06020r, tRNA, YALI1A, 601943, 602013, -, codon ... 5273, YALI0E01298g, YALI1_E01865g, mRNA, YALI1E, 186136, 186525,  ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/71c0b3/yali1-genes-plos" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://journals.plos.org/plosbiology/article/file?type=supplementary&id=info%3Adoi%2F10.1371%2Fjournal.pbio.3000710.s014"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/2e2c1c1/upregulated-intron-genes-in-lab-plos">Upregulated intron genes in LAB - PLoS</a></div> <div class="link"> <a href="/num/2e2c1c1/upregulated-intron-genes-in-lab-plos">https://journals.plos.org/plosbiology/article/file?type=supplementary&id=info%3Adoi%2F10.1371%2Fjournal.pbio.3000710.s014</a> </div> <p>11, Muc4, ENSMUSG00000079620.13, 1154.80790, 8.35357, 0.86915, 9.61118, 7.17E-22, 6.13E- ... 12.59838, 7.16797, 1.26374, 5.67201, 1.41E-08, 2.11E-07.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/2e2c1c1/upregulated-intron-genes-in-lab-plos" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://dev.biologists.org/content/132/22/4911"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/cb93a4/the-dorsocross-t-box-genes-are-key-components-of-the-regulatory-">The Dorsocross T-box genes are key components of the regulatory ...</a></div> <div class="link"> <a href="/num/cb93a4/the-dorsocross-t-box-genes-are-key-components-of-the-regulatory-">https://dev.biologists.org/content/132/22/4911</a> </div> <p>Development 2005 132: 4911-4925; doi: 10.1242/dev.02077 ... The Dorsocross genes are induced within the segmental areas of the dorsal mesoderm ... of stage 14 embryos fluorescently labeled for markers, as indicated by the color code.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/cb93a4/the-dorsocross-t-box-genes-are-key-components-of-the-regulatory-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="http://genesdev.cshlp.org/content/suppl/2016/07/11/30.13.1529.DC1/Supplemental_Tables.xlsx"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/423a10/supplemental_tables-xlsx-genes-amp-development">Supplemental_Tables.xlsx - Genes & Development</a></div> <div class="link"> <a href="/num/423a10/supplemental_tables-xlsx-genes-amp-development">http://genesdev.cshlp.org/content/suppl/2016/07/11/30.13.1529.DC1/Supplemental_Tables.xlsx</a> </div> <p>A00068, A01:391691-394204, AT4G39660, AGT2. 14, Brara.A00072, A01:413104- ... 5544, Brara.J01925, A10:15369624-15372749, AT5G15870. 5545, Brara.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/423a10/supplemental_tables-xlsx-genes-amp-development" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.genecards.org/cgi-bin/cardlisttxt.pl"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/42bce0/genes-list-as-text-genecards">Genes List as text - GeneCards</a></div> <div class="link"> <a href="/num/42bce0/genes-list-as-text-genecards">https://www.genecards.org/cgi-bin/cardlisttxt.pl</a> </div> <p>... HQ292138 HQ292139 HQ292140 HQ292141 HQ292142 HQ292143 HQ292144 ... LINC01680 LINC01681 LINC01682 LINC01683 LINC01684 LINC01685 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/42bce0/genes-list-as-text-genecards" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="http://journals.plos.org/plospathogens/article/asset?unique&id=info%3Adoi%2F10.1371%2Fjournal.ppat.1006672.s019"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/c0ec2bd/diff-expressed-zt-genes-plos">diff expressed Zt genes - PLoS</a></div> <div class="link"> <a href="/num/c0ec2bd/diff-expressed-zt-genes-plos">http://journals.plos.org/plospathogens/article/asset?unique&id=info%3Adoi%2F10.1371%2Fjournal.ppat.1006672.s019</a> </div> <p>1389, ZtritIPO323_04t01639, 1:4250848-4251874, 7.28921, 5.52153, 34.7204 ... 2581, ZtritIPO323_04t09640, 5:617324-618971, 180.981, 38.5618, 47.3829 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/c0ec2bd/diff-expressed-zt-genes-plos" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="http://www.citrusgenome.jp/genelist.html"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/1ad9ee/a-list-of-the-predicted-genes-of-satsuma">A list of the predicted genes of Satsuma</a></div> <div class="link"> <a href="/num/1ad9ee/a-list-of-the-predicted-genes-of-satsuma">http://www.citrusgenome.jp/genelist.html</a> </div> <p>Ciunshiu_m01256, scaffold00113, 500216, 502947, -. Ciunshiu_m01257 ... Ciunshiu_m16140, scaffold00180, 305601, 306797, -. Ciunshiu_m16141 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/1ad9ee/a-list-of-the-predicted-genes-of-satsuma" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="http://www.genecards.org/Search/Keyword?queryString=ATM&pageSize=-1&startPage=0"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/68665c9/atm-related-genes-genecards-search-results">ATM related genes - GeneCards Search Results</a></div> <div class="link"> <a href="/num/68665c9/atm-related-genes-genecards-search-results">http://www.genecards.org/Search/Keyword?queryString=ATM&pageSize=-1&startPage=0</a> </div> <p>... Nuclear RNA Auxiliary Factor 1 Like 4, Protein Coding, 36, GC19M041409, 1.03 ... 6330, LINC01273, Long Intergenic Non-Protein Coding RNA 1273, RNA ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/68665c9/atm-related-genes-genecards-search-results" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.genecards.org/Search/Keyword?startPage=0&queryString=C%2AC&pageSize=-1&sort=Category&sortdir=ASC"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/8ce3923/c*c-related-genes-genecards-search-results">C*C related genes - GeneCards Search Results</a></div> <div class="link"> <a href="/num/8ce3923/c*c-related-genes-genecards-search-results">https://www.genecards.org/Search/Keyword?startPage=0&queryString=C%2AC&pageSize=-1&sort=Category&sortdir=ASC</a> </div> <p>3568, RF00017-4906, RNA Gene, 5, GC05P135472, 0.25 ... 5338, LINC01582, Long Intergenic Non-Protein Coding RNA 1582, RNA Gene, 11, GC15M102793 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/8ce3923/c*c-related-genes-genecards-search-results" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="http://www.patentsencyclopedia.com/app/20130104262"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/338e776/drought-responsive-genes-in-plants-and-methods-of-their-use-">Drought Responsive Genes In Plants And Methods of Their Use ...</a></div> <div class="link"> <a href="/num/338e776/drought-responsive-genes-in-plants-and-methods-of-their-use-">http://www.patentsencyclopedia.com/app/20130104262</a> </div> <p>25 Apr 2013 ... ... 2.011458763 down 0.000629733 0.007784017 BF424030 439 48 144 ... CAGAGACGAACCTTGAGGAGA 1 1 control (188) (189) 64 J01298 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/338e776/drought-responsive-genes-in-plants-and-methods-of-their-use-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://patents.google.com/patent/US20040241653A1/en"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/73cac2/us20040241653a1-methods-for-identifying-marker-genes-for-">US20040241653A1 - Methods for identifying marker genes for ...</a></div> <div class="link"> <a href="/num/73cac2/us20040241653a1-methods-for-identifying-marker-genes-for-">https://patents.google.com/patent/US20040241653A1/en</a> </div> <p>gene ESTs_{Incyte_PD:9669481 966948. Figure US20040241653A1-20041202-C00025. gene ESTs ... Figure US20040241653A1-20041202-C01792. 1.4.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/73cac2/us20040241653a1-methods-for-identifying-marker-genes-for-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.genecards.org/Search/Keyword?queryString=HLF&sort=Score&sortdir=Ascending&startPage=0&pageSize=-1"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/339809a/hlf-related-genes-genecards-search-results">HLF related genes - GeneCards Search Results</a></div> <div class="link"> <a href="/num/339809a/hlf-related-genes-genecards-search-results">https://www.genecards.org/Search/Keyword?queryString=HLF&sort=Score&sortdir=Ascending&startPage=0&pageSize=-1</a> </div> <p>5045, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA ... 5458, RN7SKP244, RN7SK Pseudogene 244, Pseudogene, 8, GC04M088584, 0.29.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/339809a/hlf-related-genes-genecards-search-results" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://virologyj.biomedcentral.com/articles/10.1186/s12985-020-01345-7"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/33a1c73/the-four-of-structural-genes-sequences-of-a-porcine-epidemic-">The four of structural genes sequences of a porcine epidemic ...</a></div> <div class="link"> <a href="/num/33a1c73/the-four-of-structural-genes-sequences-of-a-porcine-epidemic-">https://virologyj.biomedcentral.com/articles/10.1186/s12985-020-01345-7</a> </div> <p>18 Jun 2020 ... Virology Journal volume 17, Article number: 79 (2020) Cite this article ... Virol J 17, 79 (2020). https://doi.org/10.1186/s12985-020-01345-7.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/33a1c73/the-four-of-structural-genes-sequences-of-a-porcine-epidemic-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://patents.google.com/patent/WO2001000844A2/en"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/362305b/wo2001000844a2-corynebacterium-glutamicum-genes-encoding-">WO2001000844A2 - Corynebacterium glutamicum genes encoding ...</a></div> <div class="link"> <a href="/num/362305b/wo2001000844a2-corynebacterium-glutamicum-genes-encoding-">https://patents.google.com/patent/WO2001000844A2/en</a> </div> <p>347 348 RXA00041 GR00007 1246 5 SUCROSE-6-PHOSPHATE ... 24 Homo sapiens 39,618 2-NOV-99 unordered pieces rxa01332 576 GB HTG6 AC007186 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/362305b/wo2001000844a2-corynebacterium-glutamicum-genes-encoding-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://patents.google.com/patent/DK2840142T3/en"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/30a9552/dk2840142t3-genes-and-uses-for-plant-improvement-google-">DK2840142T3 - Genes and uses for plant improvement - Google ...</a></div> <div class="link"> <a href="/num/30a9552/dk2840142t3-genes-and-uses-for-plant-improvement-google-">https://patents.google.com/patent/DK2840142T3/en</a> </div> <p>23301 26212 30851 37220 4467S (.471(,0 01446 10004 i 397 1-4 0 Rl- 4 4 Rl ... 16031 386010 38692 35176 59767 11231:02530 7330 29040 40492 59739 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/30a9552/dk2840142t3-genes-and-uses-for-plant-improvement-google-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.cell.com/trends/parasitology/comments/S1471-4922%2801%2902079-7"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/ca5613/decoding-the-language-of-var-genes-and-plasmodium-falciparum-">Decoding the language of var genes and Plasmodium falciparum ...</a></div> <div class="link"> <a href="/num/ca5613/decoding-the-language-of-var-genes-and-plasmodium-falciparum-">https://www.cell.com/trends/parasitology/comments/S1471-4922%2801%2902079-7</a> </div> <p>... Dept of Medicine, John Radcliffe Hospital, Headington, Oxford, UK OX3 9DU. Search for articles by this author. DOI:https://doi.org/10.1016/S1471-4922(01)02079-7 ... 1 codes for the variable extracellular domain and transmembrane region, and ... two domains figured prominently in the PfEMP1 extracellular region: the ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/ca5613/decoding-the-language-of-var-genes-and-plasmodium-falciparum-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="http://viridiplantae.ibvf.csic.es/ChlamyNet/cluster_5.html"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/87987e/annotation-of-the-genes-in-the-purple-cluster-chlamynet-a-">Annotation of the genes in the purple cluster - ChlamyNet, a ...</a></div> <div class="link"> <a href="/num/87987e/annotation-of-the-genes-in-the-purple-cluster-chlamynet-a-">http://viridiplantae.ibvf.csic.es/ChlamyNet/cluster_5.html</a> </div> <p>Cre16.g651550, Mitochondrial transcription termination factor family protein, AT1G74120 · g16741, calmodulin 6, ACAM-6 CAM6, AT5G21274 · PTHR23050 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/87987e/annotation-of-the-genes-in-the-purple-cluster-chlamynet-a-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.genecards.org/Search/Keyword?startPage=0&queryString=1&pageSize=-1&sort=Score&sortDir=Ascending"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/bc0c631/1-related-genes-genecards-search-results">1 related genes - GeneCards Search Results</a></div> <div class="link"> <a href="/num/bc0c631/1-related-genes-genecards-search-results">https://www.genecards.org/Search/Keyword?startPage=0&queryString=1&pageSize=-1&sort=Score&sortDir=Ascending</a> </div> <p>348, LINC01224, Long Intergenic Non-Protein Coding RNA 1224, RNA Gene, 10, GC19M024473, 0.03 ... 7396, lnc-RIT2-1, RNA Gene, 4, GC18M042186, 0.33.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/bc0c631/1-related-genes-genecards-search-results" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6582687/"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/9349a1d/association-of-key-genes-and-pathways-with-atopic-dermatitis-by-">Association of Key Genes and Pathways with Atopic Dermatitis by ...</a></div> <div class="link"> <a href="/num/9349a1d/association-of-key-genes-and-pathways-with-atopic-dermatitis-by-">https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6582687/</a> </div> <p>11 Jun 2019 ... MMP12 induces the aggregation of various inflammatory cells into ... SERPINB4, Up-regulated, 2.806586, 6.991864, 4.92E-18, 5.32E-15.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/9349a1d/association-of-key-genes-and-pathways-with-atopic-dermatitis-by-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://aem.asm.org/content/75/1/203"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/2e434ee/quantifying-nonspecific-tem-β-lactamase-(blatem)-genes-in-a-">Quantifying Nonspecific TEM β-Lactamase (blaTEM) Genes in a ...</a></div> <div class="link"> <a href="/num/2e434ee/quantifying-nonspecific-tem-β-lactamase-(blatem)-genes-in-a-">https://aem.asm.org/content/75/1/203</a> </div> <p>DOI: 10.1128/AEM.01254-08. Article · Figures & Data · Info & Metrics · PDF. Loading ... Immun.12:404-410. OpenUrlAbstract/FREE Full TextGoogle Scholar. 22.↵.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/2e434ee/quantifying-nonspecific-tem-β-lactamase-(blatem)-genes-in-a-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.nature.com/articles/s41525-020-0128-1"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/ca51c6/genes-and-genomes-and-unnecessary-complexity-in-precision-">Genes and genomes and unnecessary complexity in precision ...</a></div> <div class="link"> <a href="/num/ca51c6/genes-and-genomes-and-unnecessary-complexity-in-precision-">https://www.nature.com/articles/s41525-020-0128-1</a> </div> <p>4 May 2020 ... ... 20,000, even though the entire genome is predicted to code over 200,000 transcripts. ... A second area of application is the nature of the profound differences ... Med. 5, 21 (2020). https://doi.org/10.1038/s41525-020-0128-1.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/ca51c6/genes-and-genomes-and-unnecessary-complexity-in-precision-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="http://139.18.75.66/Leere/PRAKTIKUM/Protokolle/WS14/4/data/proteinortho.poff"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/c53d5ab/species-genes-alg-conn-melitaea_cinxia-melcinx1-0-24_edited-">Species Genes Alg.-Conn. Melitaea_cinxia.MelCinx1.0.24_edited ...</a></div> <div class="link"> <a href="/num/c53d5ab/species-genes-alg-conn-melitaea_cinxia-melcinx1-0-24_edited-">http://139.18.75.66/Leere/PRAKTIKUM/Protokolle/WS14/4/data/proteinortho.poff</a> </div> <p>... NV15177-PA AGAP004066-PA Msex2.01246-RA FBpp0083649 14 14 0.427 ... EHJ73422 DPOGS211038-PA GB51727-PA TC004918-PA CCG013314.1 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/c53d5ab/species-genes-alg-conn-melitaea_cinxia-melcinx1-0-24_edited-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.genecards.org/Search/Keyword?startPage=0&queryString=long&pageSize=-1&sort=Category&sortdir=ASC"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/c123855/long-related-genes-genecards-search-results">long related genes - GeneCards Search Results</a></div> <div class="link"> <a href="/num/c123855/long-related-genes-genecards-search-results">https://www.genecards.org/Search/Keyword?startPage=0&queryString=long&pageSize=-1&sort=Category&sortdir=ASC</a> </div> <p>2627, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA Gene, 9 ... Uncharacterized LOC101927858, RNA Gene, 5, GC07M156654, 0.11.</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/c123855/long-related-genes-genecards-search-results" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://europepmc.org/article/pmc/pmc7134609"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/5a7d62/zcurve_cov:-a-new-system-to-recognize-protein-coding-genes-in-">ZCURVE_CoV: a new system to recognize protein coding genes in ...</a></div> <div class="link"> <a href="/num/5a7d62/zcurve_cov:-a-new-system-to-recognize-protein-coding-genes-in-">https://europepmc.org/article/pmc/pmc7134609</a> </div> <p>Keywords: Coronavirus, Severe acute respiratory syndrome, SARS-CoV, ... To compare the gene-finding result of the system ZCURVE_CoV 1.0 with that of ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/5a7d62/zcurve_cov:-a-new-system-to-recognize-protein-coding-genes-in-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="http://networks.systemsbiology.net/syf/genes/"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/5807b2/genes-for-synechococcus-elongatus-pcc-7942-network-portal">Genes for Synechococcus elongatus PCC 7942 - Network Portal</a></div> <div class="link"> <a href="/num/5807b2/genes-for-synechococcus-elongatus-pcc-7942-network-portal">http://networks.systemsbiology.net/syf/genes/</a> </div> <p>Synpcc7942_0844, CDS, 3774021, chromosome, 839099, 839809 ... Synpcc7942_2383, CDS, 3774667, chromosome, 2450109, 2451260, , "Nucleotide ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/5807b2/genes-for-synechococcus-elongatus-pcc-7942-network-portal" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="ftp://ftp.rgd.mcw.edu/pub/data_release/old_data_release/GENES_HUMAN_20130816.txt"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/59d208/rgd-pipeline:-ftp-file-extracts-module:-genes-version-2-1-2-5-">RGD-PIPELINE: ftp-file-extracts # MODULE: genes-version-2.1.2.5 ...</a></div> <div class="link"> <a href="/num/59d208/rgd-pipeline:-ftp-file-extracts-module:-genes-version-2-1-2-5-">ftp://ftp.rgd.mcw.edu/pub/data_release/old_data_release/GENES_HUMAN_20130816.txt</a> </div> <p>16 Aug 2013 ... ... Abelson-related gene) 2292936;2293000 PRSTS117_H;PRSTS118_H APPROVED protein-coding ENSG00000143322 77 01259 164690 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/59d208/rgd-pipeline:-ftp-file-extracts-module:-genes-version-2-1-2-5-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://www.genecards.org/Search/Keyword?queryString=ZBTB40&startPage=0&pageSize=-1&sort=Score&sortDir=Ascending"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/920bc72/zbtb40-related-genes-genecards-search-results">ZBTB40 related genes - GeneCards Search Results</a></div> <div class="link"> <a href="/num/920bc72/zbtb40-related-genes-genecards-search-results">https://www.genecards.org/Search/Keyword?queryString=ZBTB40&startPage=0&pageSize=-1&sort=Score&sortDir=Ascending</a> </div> <p>199, FECH, Ferrochelatase, Protein Coding, 47, GC18M057544, 0.29 ... 4893, LINC01895, Long Intergenic Non-Protein Coding RNA 1895, RNA Gene, 9 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/920bc72/zbtb40-related-genes-genecards-search-results" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> <div class="grid_item" data-id="https://patents.google.com/patent/AU2001286811B2/en"> <div class="grid_item_detail"> <div class="detail_title"><a href="/num/57ee14/au2001286811b2-stress-regulated-genes-of-plants-transgenic-">AU2001286811B2 - Stress-regulated genes of plants, transgenic ...</a></div> <div class="link"> <a href="/num/57ee14/au2001286811b2-stress-regulated-genes-of-plants-transgenic-">https://patents.google.com/patent/AU2001286811B2/en</a> </div> <p>... AF244686 AAG34798.1 AF243363 AAG34837.1 AF244694 AAG34849.1 ... L3 6456 L36823 AF14 6691 Z37 991 AJ001926 AJO 01925 AJO 01924 X72 675 ...</p> </div> <div class="btns_online"> <div class="grid_btn"> <button class="preview_btn">Preview</button> <button><a href="/num/57ee14/au2001286811b2-stress-regulated-genes-of-plants-transgenic-" class="download_btn">More</a></button> </div> <div class="status"><span>Active</span></div> </div> </div> </div> </div> </div> </section> </div> <div class="link_lists"> <div class="link_item"> <h4>Related phones</h4> <ul> </ul> </div> <div class="link_item"> <h4>Last search</h4> <ul> <li><a href="/search/8000234945">8000234945</a></li> <li><a href="/search/2039665897">2039665897</a></li> <li><a href="/search/vodafone-nuisance-calls">vodafone nuisance calls</a></li> <li><a href="/search/dees-of-croydon">dees of croydon</a></li> </ul> </div> </div> <!-- section two --> </div> </div> <!-- pop up --> <div id="popup"> <div class="iframe_pop"> <!-- <div class="left_element el_ment"> <img src="img/2.jpg"> </div> --> <div class="loader_frame"> <div class="exit"> <svg version="1.1" class="exit_svg" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" x="0px" y="0px" viewBox="0 0 26.2 26.2" style="enable-background:new 0 0 26.2 26.2;margin-left: auto;" xml:space="preserve"> <style type="text/css"> .exit_vid{fill:#fff;} .exit_svg{width: 25px;height: 25px;cursor: pointer; margin-bottom: 10px;} </style> <polygon class="exit_vid" points="26.2,2.1 24,0 13.1,11 2.1,0 0,2.1 11,13.1 0,24 2.1,26.2 13.1,15.2 24,26.2 26.2,24 15.2,13.1 "></polygon> </svg> </div> <iframe src="" frameborder="0" allow="accelerometer; autoplay; encrypted-media; gyroscope; picture-in-picture" allowfullscreen=""></iframe> <div id="loader"> <div> <div class="my-progress-bar"></div> </div> </div> </div> <span class="blanked"></span> <!-- <div class="right_element el_ment"> <img src="img/2.jpg"> </div> --> </div> </div> <!-- cookie --> <div class="cookie"> <div> <p>This website uses cookies to ensure you get the best experience on our website.</p> <button class="ok">ok</button> </div> </div> <!-- footer --> <footer> <div> <div> <a rel="nofollow" href="/info/contact">Contact</a> <a rel="nofollow" href="/info/privacy">Privacy Policy</a> <a rel="nofollow" href="/info/cookies">Cookies</a> </div> <div> <a href="/">Who-callme.co.uk © 2021</a> </div> </div> <!--LiveInternet counter--><script type="text/javascript"><!-- new Image().src = "//counter.yadro.ru/hit?r"+ escape(document.referrer)+((typeof(screen)=="undefined")?"": ";s"+screen.width+"*"+screen.height+"*"+(screen.colorDepth? screen.colorDepth:screen.pixelDepth))+";u"+escape(document.URL)+ ";"+Math.random();//--></script><!--/LiveInternet--> </footer> <script type="text/javascript" src="/js/jquery-3.4.1.min.js"></script> <script type="text/javascript" src="/js/plugin.js"></script> <script type="text/javascript" src="/js/page.js"></script> <script type="text/javascript" src="/js/common.js"></script> </body> </html><script data-cfasync="false" src="/cdn-cgi/scripts/5c5dd728/cloudflare-static/email-decode.min.js"></script>