SnapNrack S-100 232-01259 162" Array Skirt - Solaris

SnapNrack S-100 232-01259 162" Array Skirt - Solaris - Related Phones

SnapNrack Skirt - 232-01259. SnapNrack, Series 100, 168 inch Skirt, 232-01259. A clean, finished look to any array. This item must be purchased in multiples of ...

Active

SnapNrack S-500 242-02036 Metal Roof Base ... SKU: ALG-242-02036. Note: ... *Last Name. *Email Address. *Phone. Zip Code. *How can we help you?

Active

11 Dec 2015 ... ... AK005158P01180 AK005158P01202 AK005164P00562 ... NM_026073P00172 NM_026073P00312 NM_026073P00618 ...

Active

... CUST_4498_PI428631609 CUST_4499_PI428631609 CUST_44_PI428631609 CUST_4500_PI428631609 CUST_4502_PI428631609 ...

Active

... RNA147229|p0333_imsncRNA743 A_24_P314451 p23475 A_24_P162454 ... p39523_v4 A_33_P3381022 p8730 p26138 A_23_P157316 p20296 p11076 ...

Active

... 108718 699973 961400 770207 297562 588565 892176 748656 913397 251731 101971 463990 664877 656099 651969 395379 446302 662026 781189 ...

Active

... HTile083514_s_at HTile083515_s_at HTile088582_s_at HTile088583_s_at HTile088584_x_at HTile088656_x_at HTile088657_s_at HTile088714_x_at ...

Active

14 May 2015 ... ... A_23_P133648 A_21_P0001106 A_24_P392060 oebiotech_01282 ... A_23_P140668 oebiotech_02650 A_23_P410700 oebiotech_14555 ...

Active

... RNA147241|p0345_imsncRNA764 RNA147242|p0346_imsncRNA765 ... RNA147527|p0631_imsncRNA366 RNA147528|p0632_imsncRNA369 ... p6667 p6668 p6669 p667 p6670 p6671 p6672 p6673 p6674 p6675 p6676 p6677 p6678 ...

Active

... RNA37694|ENCODE_2566_366 RNA58362|CombinedLit_333_517 CB_021177 ... RNA147241|p0345_imsncRNA764 RNA177200|ENST00000513381 ... CB_017042 RNA47904|UCSC_6675_1608 RNA158259|XLOC_000470 ...

Active

Пазл "Животные на лугу" Djeco 01259 по выгодной цене в магазине развивающих игрушек ELC. Заказать товар Вы можете на сайте, в оффлайн ...

Active

... .040042 -.05857 .591133 .686225 .407849 -1.4235 -.19055 -1.4235 .945567 ... 2.070839 -.01204 -1.43465 .417937 .556504 -1.38078 1.240174 1.323797 ...

Active

8 Mar 2016 ... ... SAOUHSC_00409 SAOUHSC_00410 new_411586_412518_-1 ... SAOUHSC_01199 new_1151303_1151463_1 SAOUHSC_01200 ...

Active

... ,1577,6774,5139,928,5243,1102,180,271,342,3348,995,937,0,1158,20690,0 ... ,18437,37226,7707,61433,7272,1959,108783,0,0,100.0,4.4,0.0,45.6,6.6,50.1 ...

Active

Reporter 430171 286122 AA010252 UniGeneID:Hs.211038/MAGE. ... 1654 1 8 6 10 112814/MAGE.Reporter 124139 R01246 UniGeneID:Hs.298160/MAGE.

Active

... NB:1100.m01327 NB:1100.m01328 NB:1100.m01329 NB:1100.m01330 ... TC227088 TC227090 TC227091 TC227092 TC227094 TC227101 TC227102 ...

Active

... AV768600 GE19328 TTAGACACTCAAAAAGGGTGGGAGACTAGCATATTAAGGAGCAAACTTTAAACGTAATTC BP033657;BP055338;BP053127 GE19329 ...

Active

... 3 4 306885:Reporter H01422 Experimental 35 9 3 5 306885:Reporter H01422 ... 16 2 4 303323:Reporter AF083810 Experimental 17 16 2 5 303323:Reporter ...

Active

... IMAGE:1501914 AA886421;AI733051;AI791541 775 IMAGE:278375 N64010 ... AA773608 18307 IMAGE:278516 N62817;W01352 18308 IMAGE:586990 ...

Active

... NM_145251P01202 NM_145251 TGGACTTGCAAAGAGGTATTATTGCAATAATGCACTTTTCATACTTGAAATTTATTTGTA BC022465P01738 BC022465 ...

Active

17 Jul 2013 ... ... 311991_0368_3702P00087 GATCATCGTTTTCTAGTTTGGTGAAGCGTCGCGTTGAAGGCACACCGTCGTGCTCCATTC ...

Active

... CE26339 188374_s_at ZK380.1 Q9TZL0 NP_508308 188374_s_at C36C9.2 ... CE37192 181866_at ZC581.3 O01772 IPR000719 AAB54140 181866_at ...

Active

... 4 1 18 17 116d24 47452 H11557 IMAGp998C01276 Experimental 4 1 19 17 ... 093i11 2271075 AI802149 IMAGp998J045623 Experimental 1 2 22 9 093i23 ...

Active

... CA473763 mwgzebrafish#01471 AI641308 mwgzebrafish#01472 BC044367 ... BM280150 mwgzebrafish#07646 BG306743 mwgzebrafish#07647 ...

Active

... 528307 Hs.528307 4 1 14 10 PMHS10k01622 T69563 Experimental 424099 ... 6 2 18 PMHS10k10130 AA489244 Experimental 371166 Hs.371166 2 6 3 18 ...

Active

... R01161 1339826 R01767 1339827 R01904 1339828 R02261 1339829 R02317 ... AA725903 1348023 AA732233 1348024 AA732249 1348025 AA732453 ...

Active

... AK006472P01895 CTCAGAGCTTCTCCCGGAAAGAACAGCGAGGCGAGCAGTGGGGAGGCTGCGAAGGACGAA AK006472P01956 ...

Active

... 302220_A AF228603 AAH01226 ENSG00000100558 NM_016445 3 7 6 10 ... 214279_A D43636 Q14706 ENSG00000163788 2 8 14 6 230500_A ...

Active

... 7tm_3 PR01223 1449897_a_at 1455710_x_at 1425753_a_at 1420539_a_at ... NM_008112 GDI d1d5ta2 PR00044 5.4.99.9 1420815_at AI790193 Q9R274 ...

Active

... Experimental 1 1 35 8 220244 At5g01335 CATMA5a00400 ... Experimental 2 11 41 6 216873 At2g44745 CATMA2a43200 ...

Active

... Experimental 1 1 333 1013 5758_0333_1013 ... Experimental 1 1 333 1029 5758_0333_1029 ... Experimental 1 1 338 1020 5758_0338_1020 ...

Active

S1_at NM_174205.1 P01223 Bt.475.1.S1_at Bt.475 NM_174205 281552 ENSBTAG00000006295 ... A1_at CB425895 Bt.21487.1.A1_at Bt.90211 Bt.21376.1.

Active

A1_at AL914810 IPR001440 CAG07707 Dr.12730.1.A1_at Q64HS6 393410 ... A1_at Q6PBR2 402881 Dr.14768 Dr.25513.1.A1_at BI840774 Dr.25513.1.

Active

... 114268_2_1_sc127_32388-34034_pP01484 ... 242987_4_1_sc23_699062-699223_pP00087 ...

Active

... Experimental 1 1 113 1299 5771_0113_1299 Control control_unknown_type 1 1 115 1299 ... Experimental 1 1 493 1339 5771_0493_1339 ...

Active

... gnf1m00648_a_at BC011486 gnf1m16822_at BU850357 gnf1m16823_a_at ... (Pms2), mRNA gnf1m01603_a_at Mouse paired-like homeobox 2a (Phox2a), ...

Active

... Q9Z246 9444 IPR004087 Hs.15020 212264_s_at rc_AI030030_at D87450.1 ... rc_AA875133_at AI269117 Q9Y400 25983 Hs.9043 213795_s_at L01702_at ...

Active

... H29186 10027 BM471930 10028 BE304565 10029 R20384 10030 R19879 ... W16535 12666 BM454839 12667 W07847 12668 W07759 12669 W02588 ...

Active

... H54314 203040 IMAGp998B01392 Experimental 1 7 11 22 016f06 H56033 ... 3 055o17 AA504243 825045 IMAGp998N222038 Experimental 4 8 1 4 053d05 ...

Active

... 6 016b18 H54314 203040 IMAGp998B01392 Experimental 2 7 11 6 016f06 ... 3 8 24 19 055o17 AA504243 825045 IMAGp998N222038 Experimental 3 8 1 ...

Active

1 Sep 2012 ... ... AJ564973.1 SNOWBALL_027042_st AJ564974.1 SNOWBALL_027041_s_st ... SNOWBALL_009852_st PF01603 ENSSSCG00000001654 ...

Active

... GT_Mm_44k_01244 NM_001159907 unmapped ... GT_Mm_44k_52_P634447 NM_021429 unmapped ...

Active

... NM_126763 AT2G07729.1 AT2G07730.1 AT2G07731.1 AT2G07732.1 AT2G07733.1 ... AT5G23740.1 NM_122279 AT5G23750.1 NM_122280 AT5G23760.1 ...

Active

... AM956304 SAPD08603_1 CCGTACGCCCCCGGGAGCAAACTCTTCTACAACAAACACTAGCTGACAGAAAAACACAAA AM976398 SAPD01603_2 ...

Active

... 5643 ciad055p03 BP013199 5644 citbx01372 AV678534 5645 cits046p22 ... 5888 cieg024l08 AK114844 5889 cilv061k05 BW240053 5890 cicl051m23 ...

Active

... EMPV1_01602 unmapped GCAGCCTCCAGGACCCTGGCCCCTGTCAAGCCTGGCAGCAAGTGGAGCAGCAGCTGGGTG EMPV1_01603 unmapped ...

Active

A1_at BAB01480.1 PtpAffx.12873.1.A1_at CV242873 A9P991 PtpAffx.12873.1. ... S1_s_at DN484805 PtpAffx.26075.1.S1_s_at NP_001060730 PtpAffx.3906.2.

Active

... 5218 Hs.430742 (Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) ... S1_AT NM_021964 ENSG00000114514 7707 601897 Hs.380334 ...

Active

CompositeSequence CAC01452.1 SCO1228 putative acyltransferase 2 3 5 26 ... SCO7780 putative transcriptional regulator 4 2 5 15 379104/MAGE.Reporter ...

Active

... ENSG00000165917 Z34897_at Z34897 Z34897_at AAN01269 IPB000276 ... X17059_s_at D90070_s_at D90070 1418203_at Q13794 604959 11276046 ...

Active

... NM_018393 IMAGE:147593 IMAGp998N15230 H01267;H01178;BX114131 ... IMAGp998J18262 H25907;H25906;BX090014;AI820783;AI668608 ...

Active

... E_POPLARS01481P010364 CTCACCACCTCGATGCCGACGATAACGTGATGGATGTCTCACCTGAAATCACCAAGTCGG E_POPLARS01482P010369 ...

Active

... UT01202 NM_026002 GCGTGGCCATGTCAGAGTTCTCCAACTGCATTATACCTATACCCTAAATTGAGAAACAAACAGTTGAGAG UT01203 ...

Active

... 1460723_at Q8JGW1 ENSRNOG00000016685 PR01527 729997 Rn.9673 ... Q9H6U3 Rn.33594 BF419134 1389116_at W68255_at Q8K3W5 Rn.20978 ...

Active

... 2557 208470_s_at X01792 GO:0004252 ENSG00000197711 NM_020995 ... AL139286 GO:0005850 ENSG00000092847 Hs.22867 NM_012199 606228 ...

Active

... MA","F",0,0,0,2 "01472","WEST GROTON, MA",,334,3340,13795,14 "01473" ... MA",,44111,501915,2141412,594 "02216","BOSTON, MA","A",0,0,0,3 "02217" ...

Active

Retailers tell us they have never seen such a surge in firearms sales. One kind of weapon that has been selling out is a build-it-yourself firearm known as a ghost gun because it skirts...

Active

... DAILY https://www.lazada.co.id/products/1kg-5-pcs-cavilla-cardi-motif-outer-cardi-cardan-cardy-cavilla-cardi-silver-i1267618049.html 0.5 2020-07-28 DAILY ...

Active

Claymore miner supports special arguments, which helps to fine-tune your video cards and increase hashrate and profitability. Kryptex uses Claymore to mine ...

Active

... "Linda Ashford-Buckle","[email protected]","","212 Pennsylvania Road Exeter EX4 5DZ ","01392 214760", "Marguerite Ashman","","","The Aim Clinic 3 ...

Active